IgH recombination

Masaki Miyazaki

Improve Research Reproducibility A Bio-protocol resource

Home
Protocols

Preprint

IgH recombination

MM Masaki Miyazaki

Last updated date: Sep 13, 2020 Views: 892 Forks: 0

An abbreviated version of this protocol was published in Science Immunology

The transcription factor E2A activates multiple enhancers that drive Rag expression in developing T and B cells

Download PDF

Ask a question

How to cite

Favorite

Protocol of IgH semi-quantitative PCR

Genomic DNA was purified from sorted pro-B cells (5x10⁵) by DNeasy Blood and Tissue kit (Qiagen). Semi-quantitative PCR (serial dilution with 1/4) were performed by KOD FX Neo (TOYOBO). PCR condition (94˚C;30sec – 60˚C;30sec – 68˚C;2min x 36-38 cycles).

Primer sequence

VH7183

CAGCTGGTGGAGTCTGGGGGA

VHJ558

TCCAGCACAGCCTACATGCAGCTC

JH3 down

ATTCTCACAAGAGTCCGATAGACCCTGG

Ref

Compound haploinsufficiencies of Ebf1 and Runx1 genes impede B cell lineage progression

Kara Lukin, Scott Fields, Desiree Lopez, Marie Cherrier, Kristina Ternyak, Julita Ramírez, Ann J. Feeney, and James Hagman

PNAS April 27, 2010 107 (17) 7869-7874; https://doi.org/10.1073/pnas.1003525107

How to cite：

Readers should cite both the Bio-protocol preprint and the original research article where this protocol was used:

Miyazaki, M(2020). IgH recombination. Bio-protocol Preprint. bio-protocol.org/prep496.
Miyazaki, K., Watanabe, H., Yoshikawa, G., Chen, K., Hidaka, R., Aitani, Y., Osawa, K., Takeda, R., Ochi, Y., Tani-ichi, S., Uehata, T., Takeuchi, O., Ikuta, K., Ogawa, S., Kondoh, G., Lin, Y. C., Ogata, H. and Miyazaki, M.(2020). The transcription factor E2A activates multiple enhancers that drive Rag expression in developing T and B cells . Science Immunology 5(51). DOI: 10.1126/sciimmunol.abb1455