Improve Research Reproducibility A Bio-protocol resource
bpdetail_icon_lock
Preprint

IgH recombination

MM Masaki Miyazaki

Last updated date: Sep 13, 2020 Views: 871 Forks: 0

original An abbreviated version of this protocol was published in Science Immunology in Sep, 2020
The transcription factor E2A activates multiple enhancers that drive Rag expression in developing T and B cells
download pdf Download PDF
ask Ask a question
cite How to cite
nfavorite Favorite

Protocol of IgH semi-quantitative PCR

Genomic DNA was purified from sorted pro-B cells (5x105) by DNeasy Blood and Tissue kit (Qiagen). Semi-quantitative PCR (serial dilution with 1/4) were performed by KOD FX Neo (TOYOBO). PCR condition (94˚C;30sec – 60˚C;30sec – 68˚C;2min x 36-38 cycles).

 

Primer sequence

VH7183 

CAGCTGGTGGAGTCTGGGGGA 

 

VHJ558 

TCCAGCACAGCCTACATGCAGCTC 

 

JH3 down

ATTCTCACAAGAGTCCGATAGACCCTGG 

 

Ref

Compound haploinsufficiencies of Ebf1 and Runx1 genes impede B cell lineage progression

Kara Lukin, Scott Fields, Desiree Lopez, Marie Cherrier, Kristina Ternyak, Julita Ramírez, Ann J. Feeney, and James Hagman

PNAS April 27, 2010 107 (17) 7869-7874; https://doi.org/10.1073/pnas.1003525107 

Copyright: Content may be subjected to copyright.
How to cite：
Readers should cite both the Bio-protocol preprint and the original research article where this protocol was used:
  1. Miyazaki, M(2020). IgH recombination. Bio-protocol Preprint. bio-protocol.org/prep496.
  2. Miyazaki, K., Watanabe, H., Yoshikawa, G., Chen, K., Hidaka, R., Aitani, Y., Osawa, K., Takeda, R., Ochi, Y., Tani-ichi, S., Uehata, T., Takeuchi, O., Ikuta, K., Ogawa, S., Kondoh, G., Lin, Y. C., Ogata, H. and Miyazaki, M.(2020). The transcription factor E2A activates multiple enhancers that drive Rag expression in developing T and B cells . Science Immunology 5(51). DOI: 10.1126/sciimmunol.abb1455

Category

Immunology

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A
This protocol preprint was submitted via the "Request a Protocol" track.