STAG1-AID , STAG2-AID

Design gRNAs using online tools: https://zlab.bio/guide-design-resources

EGFP-AID-STAG1 gRNA1: CACCGTCTTCAGACTTCAGAACAT, gRNA2: CACCGGTTTCTCATCATTTTTCTA.

EGFP-AID-STAG2 gRNA1: CACCGCACAGATTTAATTGTGTAC, gRNA2: CACCGCTCTCTCTCATTAGGTTCT.

Oligo annealing and cloning into gRNA expression plasmid PX335:

https://media.addgene.org/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf 

1.  Digest 1µg of PX335 with BbsI for 30 min at 37°C: 

    1 µg PX335   

    1 µl FastDigest BbsI (Fermentas)   

    1 µl FastAP (Fermentas)   

    2 µl 10X FastDigest Buffer   

    X µl ddH₂O     

    20 µl total 

2.  Gel purify digested plasmid using QIAquick Gel Extraction Kit and elute in EB. 

3. Phosphorylate and anneal each pair of oligos: 

    1 µl oligo 1 (100uM)   

    1 µl oligo 2 (100uM)   

    1 µl 10X T4 Ligation Buffer (NEB)   

    6.5 µl ddH₂O 

    0.5 µl T4 PNK (NEB)     

    10 µl total 

    Anneal in a thermocycler using the following parameters: 

    37°C 30 min, 95°C 5 min and then ramp down to 25°C at 5°C/min 

4. Set up ligation reaction and incubate at room temperature for 10 min: 

    X µl BbsI digested PX335 (50ng)   

    1 µl phosphorylated and annealed oligo duplex (1:200 dilution)   

    5 µl 2X Quickligation Buffer (NEB) 

    X µl ddH₂O       

    10 µl subtotal   

    1 ul Quick Ligase (NEB)     

    11 µl total 

5. Transformation to E.coli

6. Validate the sequence of gRNA expression plasmid by Sanger sequencing using the primer 5’-

    ACCTCGACCATGGTAATAGCG

template DNA cloning

1.  PCR N-terminal TSS containing region of STAG1/STAG2 by Phusion Hot Start II DNA Polymerase: 

    10 µl 5X Phusion HF Buffer

    1 µl 10 mM dNTPs

    1 µl Primer pair (10 uM)

    0.5 µl HeLa genomic DNA (20 ng/ul)

    0.5 µl Phusion Hot Start

    37 µl ddH₂O     

    50 µl total 
    98 °C 30s

    72°C 5min

2. Gel purified PCR product ligated to pJET vector

    5 µl 2X Reaction Buffer

    2 µl purified PCR product (20 ng/µL)

    0.5 µl pJET1.2/blunt Cloning Vector (50 ng/µL)

    0.5 µl T4 DNA Ligase

    2 µl ddH₂O 

    10 µl total  

    Incubate the ligation mixture at room temperature (22°C) for 10 min.

3. transformation to E. coli

4. Validate the sequence of gRNA expression plasmid by Sanger sequencing using the primer fw: 5'-CGACTCACTATAGGGAGAGCGGC-3' and rev: 5'-AAGAACATCGATTTTCCATGGCAG-3’

Transfection of HeLa cells

1.  1 day prior to transfection, seed HeLa cells in 10 cm² dish containing 10 mL of complete growth medium without Penicillin/Streptomycin. Grow cells overnight to approximately 50%-60% confluence.

2. Mix 4 μg template DNA, 2 μg of each gRNA with 1 mL Opti-MEM® I. 

3. Mix 40 μl Lipofectamine 2000 with 1 mL Opti-MEM® I. Incubate the mixture for 5 minutes at room temperature. 

4. Combine the diluted DNA with the diluted transfection reagent. Incubate at room temperature for 20 min.

5. Add the DNA-transfection reagent complexes to the cell and mix gently. 

6. Incubate the cells for 24h, split the cells with fresh medium containing Penicillin/Streptomycin.

7. GFP positive single cell is sorted

8. A week later singe cell colony could be used for genotyping.

Identification of homozygous knock-in cells by genotyping

1.  Genomic DNA isolation by nexttec™ 1-Step DNA Isolation Systems: https://www.nexttec.de/products/tissue-and-cells

1. Add 140 µl Buffer G and 10 µl Proteinase K to each sample. Incubate the sample with shaking (56°C, 200 rpm, 30 min to overnight)
2. Transfer 100 µl of the lysate to an equilibrated nexttec™ cleanPlate96. Incubate for 3 min at room temperature. Centrifuge at 700x g for 1 min or apply vacuum for 1 min.

2. PCR amplification of the CRISPR targeted region

    4 µl 5X Phusion HF Buffer

    0.4 µl 10 mM dNTPs

    0.4 µl Primer pair (10 uM)

    1 µl HeLa genomic DNA (20 ng/ul)

    0.2 µl Phusion Hot Start

    14 µl ddH₂O     

    20 µl total 

    98 °C 30s

    72°C 5min

EGFP-AID-STAG1 primers used for genotyping were: forward primer:GCCAGCTGGGAATCTCTTCA, and reverse primer:GCCACAGTTTGCTGACTCCT. 

EGFP-AID-STAG2 primers used for genotyping were: forward primer:AGAAAGAAGGCAAGCCACCA and reverse primer: GGCAGCAGGAAGTACCTAACT.