Advanced Search
Last updated date: May 8, 2020 Views: 1273 Forks: 0
Design gRNAs using online tools: https://zlab.bio/guide-design-resources
EGFP-AID-STAG1 gRNA1: CACCGTCTTCAGACTTCAGAACAT, gRNA2: CACCGGTTTCTCATCATTTTTCTA.
EGFP-AID-STAG2 gRNA1: CACCGCACAGATTTAATTGTGTAC, gRNA2: CACCGCTCTCTCTCATTAGGTTCT.
Oligo annealing and cloning into gRNA expression plasmid PX335:
1. Digest 1µg of PX335 with BbsI for 30 min at 37°C:
1 µg PX335
1 µl FastDigest BbsI (Fermentas)
1 µl FastAP (Fermentas)
2 µl 10X FastDigest Buffer
X µl ddH2O
20 µl total
2. Gel purify digested plasmid using QIAquick Gel Extraction Kit and elute in EB.
3. Phosphorylate and anneal each pair of oligos:
1 µl oligo 1 (100uM)
1 µl oligo 2 (100uM)
1 µl 10X T4 Ligation Buffer (NEB)
6.5 µl ddH2O
0.5 µl T4 PNK (NEB)
10 µl total
Anneal in a thermocycler using the following parameters:
37°C 30 min, 95°C 5 min and then ramp down to 25°C at 5°C/min
4. Set up ligation reaction and incubate at room temperature for 10 min:
X µl BbsI digested PX335 (50ng)
1 µl phosphorylated and annealed oligo duplex (1:200 dilution)
5 µl 2X Quickligation Buffer (NEB)
X µl ddH2O
10 µl subtotal
1 ul Quick Ligase (NEB)
11 µl total
5. Transformation to E.coli
6. Validate the sequence of gRNA expression plasmid by Sanger sequencing using the primer 5’-
ACCTCGACCATGGTAATAGCG
template DNA cloning
1. PCR N-terminal TSS containing region of STAG1/STAG2 by Phusion Hot Start II DNA Polymerase:
10 µl 5X Phusion HF Buffer
1 µl 10 mM dNTPs
1 µl Primer pair (10 uM)
0.5 µl HeLa genomic DNA (20 ng/ul)
0.5 µl Phusion Hot Start
37 µl ddH2O
50 µl total
98 °C 30s

72°C 5min
2. Gel purified PCR product ligated to pJET vector
5 µl 2X Reaction Buffer
2 µl purified PCR product (20 ng/µL)
0.5 µl pJET1.2/blunt Cloning Vector (50 ng/µL)
0.5 µl T4 DNA Ligase
2 µl ddH2O
10 µl total
Incubate the ligation mixture at room temperature (22°C) for 10 min.
3. transformation to E. coli
4. Validate the sequence of gRNA expression plasmid by Sanger sequencing using the primer fw: 5'-CGACTCACTATAGGGAGAGCGGC-3' and rev: 5'-AAGAACATCGATTTTCCATGGCAG-3’
Transfection of HeLa cells
1. 1 day prior to transfection, seed HeLa cells in 10 cm2 dish containing 10 mL of complete growth medium without Penicillin/Streptomycin. Grow cells overnight to approximately 50%-60% confluence.
2. Mix 4 μg template DNA, 2 μg of each gRNA with 1 mL Opti-MEM® I.
3. Mix 40 μl Lipofectamine 2000 with 1 mL Opti-MEM® I. Incubate the mixture for 5 minutes at room temperature.
4. Combine the diluted DNA with the diluted transfection reagent. Incubate at room temperature for 20 min.
5. Add the DNA-transfection reagent complexes to the cell and mix gently.
6. Incubate the cells for 24h, split the cells with fresh medium containing Penicillin/Streptomycin.
7. GFP positive single cell is sorted
8. A week later singe cell colony could be used for genotyping.
Identification of homozygous knock-in cells by genotyping
1. Genomic DNA isolation by nexttec™ 1-Step DNA Isolation Systems: https://www.nexttec.de/products/tissue-and-cells
2. PCR amplification of the CRISPR targeted region
4 µl 5X Phusion HF Buffer
0.4 µl 10 mM dNTPs
0.4 µl Primer pair (10 uM)
1 µl HeLa genomic DNA (20 ng/ul)
0.2 µl Phusion Hot Start
14 µl ddH2O
20 µl total
98 °C 30s

72°C 5min
EGFP-AID-STAG1 primers used for genotyping were: forward primer:GCCAGCTGGGAATCTCTTCA, and reverse primer:GCCACAGTTTGCTGACTCCT.
EGFP-AID-STAG2 primers used for genotyping were: forward primer:AGAAAGAAGGCAAGCCACCA and reverse primer: GGCAGCAGGAAGTACCTAACT.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link