Advanced Search
Last updated date: Nov 7, 2020 Views: 1656 Forks: 0
Jordan M. Welker1, Wesley A. Wierson1, Maira P. Almeida1, Carla M. Mann1, Melanie E. Torrie1, Stephen C. Ekker6, Karl J. Clark6, Drena L. Dobbs1, Jeffrey J. Essner1*, Maura McGrail1*
*Corresponding authors: jessner@iastate.edu and mmcgrail@iastate.edu
GeneWeld protocol for targeted Integration in zebrafish using CRISPR/Cas9 and pGTag vectors.
This protocol is associated with the publication Wierson, Welker, Almeida et al., Efficient targeted integration directed by short homology in zebrafish and mammalian cells. 2019 eLife.
Written by J.M. Welker
Table of Contents
A. Introduction
The GeneWeld strategy and pGTag vector series are designed for straightforward assembly of vectors containing short homology arms for efficient CRISPR/Cas9 directed recovery of germline precision targeted integration alleles.

Figure 1. Targeted integration of pGTag vector cargo DNA into a 5’ coding exon. Short homology arms complementary to the 5’ (green) and 3’ (blue) sequences of the genomic target site are cloned on the 5’ and 3’ sides of the vector cargo DNA. The short homology arm cargo cassette is flanked by two universal guide RNA UgRNA sites. CRISPR/Cas9 simultaneously targets double strand breaks at the sgRNA genomic target site and at the UgRNA sites flanking the cargo on the plasmid donor. Exonuclease end resection liberates single stranded DNA in the vector homology arms that is complementary to the resected strands on the 5’ and 3’ sides of the genomic double strand break. The complementary sequences direct homology mediated end joining integration of the cargo DNA at the exon target site. PAM sequences are underlined and small black arrows indicate Cas9 cut sites in the genome and vector.
B. Selection of a CRISPR/spCas9 target site downstream of the first AUG in the gene of interest
Zebrafish wild type strains in common use are polymorphic. It is highly recommended to first sequence the target exon in the genomic DNA from your fish strain and use this sequence to design sgRNAs.
sgRNA site selection and guide ordering
1. To identify an exon in a gene for targeted integration, view the gene model on a genome browser, and download the gene sequences.
a. At <ensemble.org> Search for the gene name of interest for the species of interest and open the Transcript page.
b. In the left-hand side bar click on ”Exons” to find the first coding exon and initiation ATG. If there are alternative transcripts for the gene, make sure there are not alternative initiation ATGs. If there are alternative start codons, target the first exon that is conserved in all transcripts to generate a strong loss of function allele.
c. Download the cDNA and target exon as separate sequence files.
d. Using ApE <http://biologylabs.utah.edu/jorgensen/wayned/ape/> or SnapGene annotate the coding sequence with the exons.
e. Design primers to amplify the target exon from fin clip genomic DNA and sequence the amplicon. Use this sequence to identify sgRNA sites.
2. This updated protocol no longer includes in vitro synthesis of sgRNAs. Our standard protocol now uses guides ordered from a company, such as Synthego or IDT, which are highly efficiency and eliminate the need for a GG or G at the 5’ end of the sgRNA. Moreover, Hoshijima and Grunwald have shown that addition of 5’ GG to sgRNAs that do not have 5’ GG at the genomic target site significantly inhibits DSB activity (Hoshijima et al., 2019).
sgRNA sites can be identified by manual inspection of genomic DNA or other selective software such as CRISPR Design Tool (https://www.synthego.com/products/bioinformatics/crispr-design-tool) that searches independent of the 5’ GG criteria for in vitro synthesis.
If in vitro synthesis will be used for guide RNA synthesis, CRISPRScan (http://www.crisprscan.org/) (Moreno-Mateos et al., 2015) can be used to identify exon target sites:
a. Select the “Predict gRNAs” on the right-hand side of the home page of the CRISPRScan website.
b. Paste the exon sequence into the indicated box. If the exon is very large, start with a small amount of sequence, ~200 bp around the desired target region in the exon.
c. Select “Zebrafish (Danio rerio)” as the species.
d. Select “Cas9 – nGG” as the enzyme.
e. Select “In vitro T7 promoter”.
f. Click on “Get sgRNAs.” Examine the output. The generated targets are ranked by CRISPRScan from high to low. Select a target site (the 20 bp that are capitalized in the oligo column) from those given by CRISPRScan using the following criteria (The best gRNAs will have all of these):
g. Annotate the selected target sequence and NGG PAM in the cDNA sequence files.
3. Design ~20 bp DNA primers for a PCR amplicon of ~130 bp of DNA surrounding the sgRNA target site. These primers will be used to amplify genomic DNA from embryos after injection of CRISPR reagents to test for mutagenesis at the target site. The presence of indels at the target site can be detected in the PCR products in multiple ways, including gel electrophoresis to visualize heteroduplex formation, resistance to restriction enzyme digestion at a site overlapping the sgRNA target, or direct sequencing followed by ICE analysis (https://www.synthego.com/products/bioinformatics/crispr-analysis).
Locate the target sequence, including the PAM sequence (italicied below), and predict the cut site (3 bp into the target sequence from the PAM represented here by the ‘x’). Mark the targeted exon sequence approximately 65-150 bp on both sides of the cut site by putting [square brackets] around it. Primer3 will design primers outside this sequence. This design allows the primers to be used for both checking of mutagenesis and for junction fragment analysis when checking for integration.
Example:
CGGCCTCGGGATCCACCGGCC[AGAATCGATATACTACGATGAACAGAGCAAATTTGTGTGTAATACGGTCGCCACCATGGCCTxCCTCGGTTTGCTACGATGCATTTGCACCACTCTCTCATGTCCGGTTCTGGG]AGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTCCGTGAAC
Preparation of SpCas9 mRNA
C. Injection of sgRNA and spCas9 mRNA
The injections are designed to deliver 25 pg of sgRNA and 300 pg of Cas9 mRNA in a 2 nL volume to embryos at the one-cell stage.
Injection trays are cast with 1.2% agarose with 1X embryo media (Zebrafish Book; zfin.org) in polystyrene petri dishes (Fisher No. FB0875713). Injection trays can be used multiple times and stored at 4*C for up to three weeks between use.
Microcapillary glass needles are pulled from Kwik-Fil borosilicate glass capillaries (No. 1B100-4) on a Sutter Instruments Flaming/Brown Micropipette Puller (Model P-97).
Injection samples contain the following diluted in RNF water or injection buffer (final concentration: 12.5 mM HEPES pH 7.5, 25 mM Potassium Acetate, 37.5 mM Potassium Chloride, 0.0125 % glycerol, 0.025 mM DTT ph 7.5)
a. 12.5 ng/μL of genomic sgRNA
b. 150 ng/μL of mRNA for Cas9
D. Testing for indel production/mutagenesis
Phenotypic scoring of embryos
Digestion of embryos for isolation of genomic DNA for mutagenesis analysis
Genomic DNA (GDNA) can be isolated from zebrafish embryos aged between 1 and 5 dpf using this protocol. Embryos can be analyzed as individuals or as pools (maximum 5) from the same injection.
7. Vortex samples and then spin the tubes down again. The embryos should be completely dissolved.
Analysis of CRISPR/Cas9 mutagenesis efficiency at targeted gene locus.
Set up the following PCR reactions for each tube of embryo digested genomic DNA using the primers designed at the end of section A, page 10.
12.5 μL of 2x GoTaq Mastermix
1 μL of Forward Primer (10 uM)
1 μL of Reverse Primer (10 uM)
1 μL of gDNA template (digested embryos)
9.5 μL of nuclease-free water
25 μL total
E. Design short homology arms
Homology directed gene targeting allows the seamless integration of exogenous DNA into the genome with precise repair events at the target site. However, designing and cloning individual targeting vectors and homology arms for each gene of interest can be time consuming. The pGTag vector series and webdesign tools provide versatility and ease to generate knockout alleles (Figure 3). The vectors contain BfuAI and BspQI type II restriction enzymes for cloning of short homology arms (24 or 48 bp) using Golden Gate cloning. The pGTag vectors require in-frame integration for proper reporter gene function. The reporter gene consists of several parts. A 2A peptide sequence causes translational skipping, allowing the following protein to dissociate from the locus peptide. The eGFP, TagRFP, or Gal4VP16 reporter coding sequences have a number of options for localization signals, including cytosolic (no signal), a nuclear localization signal (NLS), or a membrane localization CAAX sequence. Finally, translation is terminated by one of two different transcription termination polyadenylation (pA) sequences; the 3’UTR region of the zebrafish b-actin gene or the SV40 viral pA sequence.
For many genes, the level of endogenous gene expression is not high enough to produce a detectable fluorescence signal from the integrated reporter gene. The Gal4VP16 pGTag vector in combination with a transgenic Tol2<14XUAS/RFP> reporter line allows for amplification of the signal. A 14XUAS/RFP Tol2 plasmid is provided to make a transgenic line for use with the Gal4VP16 vector.
Plasmid sequence maps can be downloaded at www.genesculpt.org/gtaghd/

Figure 3. The pGTag vectors allow one step cloning of homology arms.
All vectors can be obtained through Addgene (www.addgene.org). Because the pGTag plasmids contain repeated sequences, vector recombination can occur in bacteria. We suggest using NEB Stable E. coli. Bacteria should be grown at 30oC to reduce further the possibility of vector recombination. It is also recommended that preps of vector be checked by digesting with diagnostic enzymes followed by separation on an agarose gel.
Homology Arm Design at GTagHD www.genesculpt.org/gtaghd/
The web tool GTagHD www.genesculpt.org/gtaghd/ allows for quick design of oligos to generate short 24 or 48 bp homology arms complementary to the target site in a gene of interest.
Two complementary oligos with overhangs are annealed to generate the double stranded homology arm for cloning into the pGTag vector.
To use the tool, choose the "Submit Single Job" tab. Follow the instructions in the tab.
The sequences of two pairs of complementary oligos will be returned, one pair for the 5’ homology arm, the other pair for the 3’ homology arm.
If there are problems with the sequences and values that were entered, the web page will display the errors and advice on how to fix them.
Manual Homology Arm Design
The following protocol describes how to design homology arm oligos manually. This is also recommended to double check your output from above.
*Note* In the following section, orientation of target sites and homology is in the context of the reading frame of the genetic locus of interest. Example: A 5’ template strand CRISPR means that the target site for the CRISPR is on the template strand at the locus and is toward the 5’ end of the gene. Upstream homology domains are 5’ of the CRISPR cut site and downstream homology domains are 3’ of the cut site with respect to the gene being targeted. Also note: Upper case and lower case bases are not specially modified; this is simply a visual marker of the different parts of the homology arms.
Upstream Homology Arm Design
1) Open the sequence file for the gene of interest and identify the CRISPR site. (In this example it is a Reverse CRISPR target in Yellow, the PAM is in Orange, coding sequence is in purple)
Copy the 48 bp 5’ of the CRISPR cut (the highlighted section below) into a new sequence file; this is the upstream homology.

2) Observe the next three bases immediately upstream of the 48 bp of homology, and pick a base not present to be the 3 bp spacer between the homology and the Universal PAM in the vector. (Here the three bases are “GGA” so “ccc” was chosen for the spacer)
Add the spacer to the new file 5’ (in front) of the homology, see below. The spacer acts a non-homologous buffer between the homology and the eventual 6 bp flap from the universal guide sequence that will occur when the cassette is liberated and may improve intended integration rates over MMEJ events.

3) Determine where the last codon is in the homology. Here the 3’ G in the homology domain is the first base in the codon cut by this CRISPR target. Complete the codon by adding the remaining bases (called padding on GTagHD) for that codon from your sequence to ensure your integration event will be in frame.

4) Add the BfuAI enzyme overhang sequences for cloning, to the ends of the homology domain. 5’-GCGG and 3’-GGAT. (Here both overhangs are added to prevent errors in copying sequence for the oligos in the next two steps.)

5) The Upstream Homology Oligo A will be this sequence from the beginning to the end of the last codon (see highlighted below). Copy and paste this sequence into a new file and save it. In this example this oligo sequence is 5’-GCGGcccGTTTTCTTACGCGGTTGTTGGATGAAATCTCCAACCACTCCACCTTCGtg-3’.

6) The Upstream Homology Oligo B will be the reverse complement of this sequence from beginning of the spacer to the end of the sequence (see highlighted below). Copy the reverse complement, paste it into a new file, and save it. In this example this oligo sequence is 5’-ATCCcaCGAAGGTGGAGTGGTTGGAGATTTCATCCAACAACCGCGTAAGAAAACggg-3’.

Downstream Homology Arm Design
7) Open sequence file for the gene of interest and identify the CRISPR site. (Reverse CRISPR target in Yellow, PAM in Orange, coding sequence is in purple)
Copy the 48 bp 3’ of the CRISPR cut into a new sequence file; this is the downstream homology.

8) Observe the next three bases downstream of the 48 bp of homology, and pick a base not present to be the 3 bp spacer between the homology and the Universal PAM in the vector. (Here the bases are “CTG” so “aaa” was chosen for the spacer.)
Add the spacer to the new file 3’ of (after) the homology.

9) Add the BspQI enzyme overhang sequences for cloning, to the ends of the homology domain. 5’-AAG and 3’-CCG. (Here both overhangs are added to prevent errors in copying sequence for the oligos in the next two steps.)

10) The Downstream Homology Oligo A will be this sequence from the beginning of the sequence to the end of the spacer (see highlighted below). In this example this oligo sequence is 5’-AAGTGGGCAAGATATGGCTCACGTTATTCATCATCTTCCGCATTGTTTTGAaaa-3’.

11) The Downstream Homology Oligo B (will be the reverse complement of this sequence from the beginning of the homology to the end of the sequence (see highlighted below). In this example this oligo sequence is 5’-CGGtttTCAAAACAATGCGGAAGATGATGAATAACGTGAGCCATATCTTGCCCA-3’

F. One Pot Cloning of Homology Arms into pGTag Vectors
**Note if the homology arm oligos contain either the sequence “5’-ACCTGC-3’” or “5’-GAAGAGC-3’” (or their complements) the cloning reaction will be less efficient.
*Note some sequences just don’t work very well.
If One Plot cloning is unsuccessful, the 5’ and 3’ homology arms can be cloned sequentially into the vector using gel purified linear plasmids digested with the appropriate enzyme.
1-Pot Digest
Assemble the following:
4.0 μL dH2O
2 μL Plasmid at 50 ng/uL
1 μL 10x Buffer 3.1 from NEB
1 μL 5' annealed homology arm
1 μL 3' annealed homology arm
0.5 μL BfuAI enzyme from NEB
0.5 μL BspQI enzyme from NEB
10 uL total
Incubate at 50oC for 1 hr, place on ice.
Ligation
Add the following:
3 uL 5x T4 quick ligase buffer
1.5 uL dH2O
0.5 uL T4 quick ligase
15 uL total
Incubate 8-10 min at room temperature (to overnight). Store at -20 oC,
Growing colonies
Pick 3 white colonies from each plate and grow in separate glass culture tubes with 3 mL LB/Kanamycin, overnight at 30oC.
Or to pre-screen colonies by colony PCR:
a. Pick up to 8 colonies with a pipet tip and resuspend them in separate aliquots of 5 μL dH2O. Place the tip in 3 ml of LB/Kan, label, and store at 4oC.
b. Make a master mix for your PCR reactions containing the following amounts times the number of colonies you picked.
7.5 μL 2x GoTaq mastermix
5.5 μL dH2O
0.5 μL primer at 10 uM “F3'-check” 5'- GGCGTTGTCTAGCAAGGAAG -3'
0.5 μL primer at 10 uM “3’_pgtag_seq”5'-ATGGCTCATAACACCCCTTG-3'
14 μL total
c. Aliquot 14 μL of mixed master mix into separate labeled PCR tubes.
d. Add 1 μL of colony to each reaction as template.
or 20 ng purified plasmid as control.
e. Cycle in a thermocycler
95oC 2 minutes
95oC 30 seconds ]
57oC 30 seconds ] x 35 cycles
72oC 30 seconds ]
72oC 5 minutes
4oC hold
f. Run 5 μL of PCR product on a 1% agarose gel. You should get bands that are a different size than the control.
The 5’ homology arm can be sequenced by the 5'_pgtag_seq primer:
5'-GCATGGATGTTTTCCCAGTC-3’.
The 3’ homology arm can be sequenced with the “3’_pgtag_seq”primer:
5'-ATGGCTCATAACACCCCTTG-3'.
G. Injection of GeneWeld Reagents (spCas9 mRNA, Universal sgRNA (UgRNA), genomic sgRNA and pGTag homology vector) into 1-cell zebrafish embryos
Prepare and collect the following reagents for injection
Embryo Injections for Integration of pGTag vectors
Injections are performed into single cell embryos at a volume of 2nl per embryo containing the following concentration of RNAs and vector:
Injection mixture: Final amount per embryo:
75 pg/nl of nCas9n mRNA 150 pg of nCas9n mRNA
12.5 pg/nl of genomic sgRNA 25 pg of genomic sgRNA
12.5 pg/nl of UgRNA 25 pg of UgRNA
5 pg/nl of pGTag DNA 10 pg of pGTag DNA
H. Examine embryos for fluorescence and integrated vector-genomic junction fragments
Embryos are examined for fluorescence under a Zeiss Discovery dissecting microscope with a 1X objective at 70-100X magnification.
The type of light source used for fluorescent protein activation significantly affects the ability to visualize fluorescence signals. The Excite metal halide and LED square minicube light sources both work well to visualize fluorescence after somatic targeting.
If weak signals are observed, embryos are manually dechorionated, and viewed on glass depression well slides. Embryos displaying widespread fluorescence in expression domains consistent with the targeted gene are examined for junction fragments by PCR or raised to adulthood for outcrossing. If no or weak signals are observed, integration of pGTag-Gal4VP16 can be used to amplify reporter expression in the 14XUAS-RFP transgenic line (Balciuniene et al., 2013).
Analysis of F0 junction fragments between the genomic locus and the integrated targeting vector is carried out by isolating DNA from individual embryos followed by PCR. The following primers are used for junction fragment analysis and must be paired with gene specific primers (5’ to 3’):
5’ pGTag junctions:
R-Gal4-5'juncM GCCTTGATTCCACTTCTGTCA plus gene specific forward primer
R-RFP-5'junc CcttaatcagttcctcgcccttagA “
R-eGFP-5'-junc gctgaacttgtggccgttta “
3’ pGTag junctions:
F-Gal4-3'juncM GCAAACGGCCTTAACTTTCC plus gene specific reverse primer
F-Gal4-3'juncJ CTACGGCGCTCTGGATATGT “
F-RFP-3'junc cgacctccctagcaaactgggg “
F-eGFP-3'junc Acatggtcctgctggagttc “
To control for PCR amplification artifacts as described in (Won and Dawid, 2017), embryos injected with targeting reagents minus the genomic sgRNA are also analyzed by junction fragment PCR.
F-Gal4-3'juncM and F-Gal4-3'juncJ are alternate primers for amplification of junction fragments from the Gal4 cassette which may increase primer specificity, depending on the target gene.
7.5 μL 2x GoTaq mastermix
5.5 μL dH2O
0.5 μL primer at 10 uM genomic primer
0.5 μL primer at 10 uM pGTag primer
14 μL total
95oC 2 minutes
95oC 30 seconds ]
55oC 30 seconds ] x 35 cycles
72oC 30 seconds ]
72oC 5 minutes
4oC hold
F0 animals that are positive for reporter gene expression are raised to adulthood and outcrossed. Progeny are examined for reporter gene fluorescence as above to recover stable F1 germline alleles. The Gal4VP16 system can lead to silencing resulting in mosaic patterns in F1 embryos.
F1 fluorescence positive embryos are tested for precise transgene integration by junction fragment PCR as described above. F1 siblings are raised to adulthood and flin-clipped to identify individuals with precise targeted transgene integration. Positive F1 adults are used to establish F2 families. F1s are also sacrificed at 3 weeks post fertilization to the confirm location and precision of targeted integrations by genomic Southern Blot RFLP analysis. F0 and F1 identified fish can be incrossed or crossed to a known indel allele to gain an initial assessment of the mutagenicity of the targeted integration allele. It is recommended that established lines are maintained by outcrossing to wild type.
References:
Balciuniene, J., Nagelberg, D., Walsh, K.T., Camerota, D., Georlette, D., Biemar, F., Bellipanni, G., and Balciunas, D. (2013). Efficient disruption of Zebrafish genes using a Gal4-containing gene trap. BMC Genomics 14, 619.
Hoshijima, K., Jurynec, M.J., Klatt Shaw, D., Jacobi, A.M., Behlke, M.A., and Grunwald, D.J. (2019). Highly Efficient CRISPR-Cas9-Based Methods for Generating Deletion Mutations and F0 Embryos that Lack Gene Function in Zebrafish. Dev Cell 51, 645-657 e644.
Jao, L.E., Wente, S.R., and Chen, W. (2013). Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A 110, 13904-13909.
Moreno-Mateos, M.A., Vejnar, C.E., Beaudoin, J.D., Fernandez, J.P., Mis, E.K., Khokha, M.K., and Giraldez, A.J. (2015). CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat Methods 12, 982-988.
Won, M., and Dawid, I.B. (2017). PCR artifact in testing for homologous recombination in genomic editing in zebrafish. PLoS One 12, e0172802.
Related files
Welker et al Protocol.docx Category
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link