CRISPR/Cas9-mediated gene editing

CRISPR/Cas9-mediated gene editing for A549 Revertant cell line generation

CRISPR/Cas9 DNA

All DNA constructs and the ssODN oligonucleotide were designed and synthesized by TransOMIC Technologies (Huntsville, AL).

Each of the guide RNAs and the CRISPR/Cas9 machinery were supplied in an all-in-one vector with a green fluorescent protein called pCLIP-ALL-hCMV-ZsGreen designed by TransOMIC Technologies. 

sgRNA-NT: GGAGCGCACCATCTTCTTCA

K-Ras targeting sgRNA-1: CTGAATTAGCTGTATCGTCA

K-Ras targeting sgRNA-2: AATGACTGAATATAAACTTG

ssODN: 5’-TATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTAGTAGTAGGAGCTGGTGG

TGTAGGCAAGAGTGCATTGACGATACAGCTAATTCAGAATCATTTGTGGACGAAT-3’

A549 cell transfection using OMNIfect transfection reagent 

1. Plate 80,000 A549 cells in each well of a 24-well cell culture treated dish in 500µL growth media (RPMI 1640, 10% FBS, 1% penicillin-streptomycin) and incubate at 37°C for 16 hours (produces 80-90% confluency)
2. Wash cells twice with serum free RPMI media and add 250µL serum free RPMI media to each well
3. Dilute 0.5µg vector containing either NT control guide RNA, K-Ras targeting sgRNA-1, or K-Ras targeting sgRNA-2  (pCLIP-ALL-hCMV-ZsGreen) and 0.5µg ssODN oligo in 25µL OptiMEM I Reduced Serum Medium
4. Prepare 2µL OMNIfect transfection reagent in 23µL OptiMEM I Reduced Serum Medium
5. Mix diluted DNA and OMNIfect transfection reagent mixture together and incubate at room temperature for 20 minutes in the dark
6. Add the transfection mixture (50µL) to one well of the 24-well plate
7. Incubate the cells with the transfection mixture for 6 hours at 37°C
8. After 6 hours, add 250uL of growth media without antibiotic to the cells and incubate for an additional 48 hours at 37°C
9. Assess fluorescence by fluorescent microscopy (ZsGreen excitation 493, emission 505)

Fluorescence Assisted Cell Sorting (FACS) using BD FACSAria III

FACS was performed with the help of the University of Arizona Flow Cytometry Shared Resource core facility. Sample preparation is described below

1. 100µL trypsin was added to each well with fluorescent cells identified by fluorescent microscopy
2. Resuspend transfected cells to a concentration between 1-5 million cells/mL in RMPI 1640 media with 1% FBS in 1.7mL Eppendorf tube
3. After FACS, positive cells were collected in 15mL centrifuge tube containing RPMI 1640 media with 30% FBS for cell recovery

Cloning by Limiting Dilution

1. Each population of positive (fluorescent) cells was diluted by serial dilution to obtain a solution that has a concentration of 0.8 cells/100µL (8 cells/mL)
2. 100µL of the cell suspension was added to each well of a 96-well plate
3. Cells were incubated for 14-21 days with growth media (RPMI 1640, 10% FBS, 1% penicillin-streptomycin) until wells reached about 70% confluency. Growth media was changed every 3 days
4. Once wells reached 70% confluency, the cells were trypsinized and removed to a single well of a 24-well plate and incubated again for 3-7 days until wells reached 70% confluency. Growth media was changed every 3 days.
5. Once wells reached 70% confluency, the cells were trypsinized and removed to a 6-well plate, and then a 10cm dish, following the same steps as in 4. Once 70% confluency was achieved in 10cm dishes, cells were frozen and stored in liquid nitrogen as individual cell stocks.

Confirming Gene Editing

1. Clones were imaged by fluorescent microscopy for ZsGreen protein expression throughout the cloning process.
2. Once cell stocks were achieved, genomic DNA was collected from the clones using the Quick-DNA Miniprep Plus Kit from Zymo Research (D4068; Irvine, CA). 
3. DNA was sent for sequencing at CD Genomics (Shirley, NY)