Advanced Search
Last updated date: Sep 8, 2022 Views: 690 Forks: 0
1. PURPOSE
This method is for performing a reverse transcriptase real-time quantitative polymerase chain reaction (RT-qPCR) assay developed for the quantification of SARS-Co V-2 genomic and subgenomic content in RNA targeting the N gene and E gene of SARS CoV-2 isolated from animal tissues, feces, and fluids.
Method Summary | |
| Assay Type | Reverse Transcriptase Real-Time Quantitative PCR |
| Reference Standards | SARS-CoV-2 N gene RNA SARS-CoV-2 E gene RNA |
| Species | Hamster, Mouse, NHP, AGM |
| Sample Treatment | RNA Isolation |
| Sample Volume (Tissue Homogenate) | 400µL |
| PCRRun Time | Approximately 1 hour, 20 minutes |
| Assay Range | 5.0E+7 copies/µL RNA to 5.0E+O copies/µL RNA |
| Unprocessed Tissue Sample Storage | < -60°C. |
| Special Conditions Required | NIA |
2. EQUIPMENT (as listed or equivalent)
The following equipment, or its equivalent, is utilized during the execution of the method:
| Equipment | Vendor/Model, PN, SN, or Cat No. |
| Class II Biosafety Cabinet (BSC) | Baker Company SG603A-HE or SG603A |
| Tissue Homogenizer | Tissue Lyser, Qiagen |
| Nanodrop 2000 | Thermo Scientific |
| Magnetic Extracton System | KingFisher Flex, Thermo Scientific |
PCR System | Stratagene MX3005P BioRad CFX384 Touch BioRad CFX 96 |
| Liquid Handling Workstation | epMotion 5075t |
| Centrifuge | Beckman Coulter |
| Microcentrifuge | Eppendorf 5430 or 5453 |
| PCR Plate Spinner | VWR 89184-608 |
| Master Mix Workstation | CBS Scientific P-030-20 |
| Nucleic Acid Workstation | CBS Scientific P-030-20 |
Vortex mixer | VWR Lab Dancer or VWR Analog Vortex Mixer or VWR Mini Vortexer MV1 or Fisher Scientific Mini Roto S56 |
| Plate shaker | Labnet S2020-P4 |
| Minifuge | VWR Galaxy Ministar C1413V-115 |
| Refrigerator | Frigidaire FRU17B2JW13 or FRU17B2JW16 |
| Freezer | Fisher Scientific 301N0001 |
| Ultralow Freezer | Forma Scientific, Sanyo, Panasonic |
| Single and 12-Channel Pipettes | Various |
3. REAGENTS AND MATERIALS
The following reagents and materials, or the equivalent, are utilized during the execution of the method:
Reagent | Manufacturer | Cat. No.** |
| SARS-CoV E-gene RNA | LBRI | N/A |
| Isolated RNA From Tissues and Fluids | LBRI | N/A |
| Direct-Zol 96-RNA | Zymo Research | R2055 |
| Direct-Zol 96 Mag Bead | Zymo Reasearch | R2101 |
| Taqman® Fast Virus 1-Step Master Mix | Thermo Fisher | 4444432 |
| TaqPath® 1-Step Multiplex Master Mix (no ROX) | ThermoFisher | A28522 |
N2 Forward#: 5’ TTACAAACATTGGCCGCAAA 3’ | IDT DNA | N/A |
N2 Reverse#: 5’ GCGCGACATTCCGAAGAA 3’ | IDT DNA | N/A |
N2 Probe FAM#: 6FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ-1 | IDT DNA | N/A |
sgLead Forward#: 5’-CGATCTCTTGTAGATCTGTTCTC-3’ | IDT DNA | N/A |
E Sarbeco Reverse#: 5’- ATATTGCAGCAGTACGCACACA-3’ | IDT DNA | N/A |
E Sarbeco HEX Probe#: 6HEX-ACACTAGCCATCCTTACTGCGCTTCG- BHQ-1 | IDT DNA | N/A |
E Sarbeco Forward#: 5’-ACAGGTACGTTAATAGTTAATAGCGT-3’ | IDT DNA | N/A |
| Nuclease-free Water | BioExpress* | G-3250-125 |
| ELIMINase Decontaminant | Decon Labs Inc.* | 1101 or 1102 |
| 100% Isopropanol | Sigma Aldrich | 190764 |
| 100% Ethanol | Sigma Aldrich | SHBK1399 |
| 96-well Semi-skirted Reaction Plate or equivalent | USA Scientific* | 1402-9700 |
| MicroAmp Optical 8-Cap Strip | Applied Biosystems* | 4323032 |
| 384-well Hard-Shell PCR Plates, thin wall, skirted, black/white | BioRad * | HSP3865 |
| Microseal 'B' PCR Plate Sealing Film | BioRad * | MSB1001 |
| Aerosol Resistant tips, various sizes | Rainin* | Various |
| MicrocentrifugeTubes, DNAse/RNAse Free (1.5 mL, 2.0 mL, 5.0 mL) | Eppendorf* | Various |
| Centrifuge Tubes, Sterile (50 mL) | Fisher Scientific* | 06-443-18 |
| Reagent Reservoirs, DNAse/RNAse Free | Phoenix Research* | RRV-2013 |
* Equivalent manufacturer is acceptable.**Provided Catalog (Cat.) Number may change with changes in quantities, volumes, concentrations, or manufacture/supplier.
#Individual components may be mixed to create the assay
4. INSTRUMENT CONDITIONS
4.1 RT-qPCR conditions for amplification of SARS-CoV-2 N-gene and E-gene on Stratagene Instrument:
Parameter | Reverse Transcription | Initial Denaturation | qPCR (40 cycles) | |
| Hold | Hold | Denature | Anneal/Extend | |
| Temperature | 50ºC | 95ºC | 95ºC | 60ºC |
| Time (mm:ss) | 5:00 | 00:20 | 00:03 | 0:30 |
Total run time for all cycles is approximately 1h 20m
4.2 RT-qPCR conditions for amplification of SARS-CoV-2 N-gene and E-gene on BioRad CFX Instrument:
Parameter | Reverse Transcription | Initial Denaturation | qPCR (40 cycles) | |
| Hold | Hold | Denature | Anneal/Extend | |
| Temperature | 50ºC | 95ºC | 95ºC | 60ºC |
| Time (mm:ss) | 5:00 | 00:20 | 00:03 | 0:30 |
Total run time for all cycles is approximately 1h 20m
5. Preparations
5.1 RNA Isolation Kit: Obtain a Direct-Zol 96-RNA Kit or Direct-Zol 96 MagBead Kit and prepare the wash buffer reagents according to manufacture instructions. Kits expire 1 year after receipt date. Record receipt date on kit box or packing slip. Store kit components at appropriate temperature based on manufactures recommendations.
5.2 SARS-CoV-2 N gene and E gene RNA: SARS-CoV-2 N gene and E gene RNA is diluted to a concentration of 1E9 copies/µL. Aliquot the diluted stock RNA at an appropriate volume and store at -80°C. Expiration not determined.
5.2.1 Perform serial dilution of SARS-CoV-2 N gene and E gene RNA to generate Standard Calibration Curve. Refer to section 8.2 for dilution calculations.
5.2.2 Prepare a discrete SARS-CoV-2 N gene and E gene RNA amplification control from standard 4. Refer to section 8.2 for dilution calculations.
5.3 SARS-CoV-2 N gene Assay Mix for standard curve, controls, and samples: Prepare N gene assay mix according to the following table
Material (100 µM) | Volume to Add (µL) | Final Concentration |
N2-FWD | 333 | 20 µM |
N2-REV | 333 | 20 µM |
N2 FAM-PRB | 83.3 | 5 µM |
TE Buffer | 4250.8 | NA |
5.4 SARS-CoV-2 E gene Assay Mix for standard curve and controls: Prepare E gene assay mix according to the following table
Material (100 µM) | Volume to Add (µL) | Final Concentration |
E Sarbeco-FWD | 333 | 20 µM |
E Sarbeco-REV | 333 | 20 µM |
E Sarbeco HEX-PRB | 83.3 | 5 µM |
TE Buffer | 4250.8 | NA |
5.5 SARS-CoV-2 E gene Assay Mix for study samples: Prepare E gene assay mix according to the following table
Material (100µM) | Volume to Add (µL) | Final Concentration |
sgLead-FWD | 333 | 20 µM |
E Sarbeco-REV | 333 | 20 µM |
E Sarbeco HEX-PRB | 83.3 | 5 µM |
TE Buffer | 4250.8 | NA |
6. Sample Preparation
6.1 Tissue and Feces Samples
6.1.1 Remove pre-weighed (≤75mg) tissue or feces from frozen storage. Samples should be maintained frozen until addition of TRI reagent (or equivalent). The samples do not need be maintained frozen once in TRI reagent. NOTE: If tissues have been stored in RNA Later, samples may be allowed to thaw since the RNA Later will stabilize the nucleic acids in the sample. It is also important to blot each sample to remove any residual RNA Later and transfer to a new 2mL safe-lock tube.
6.1.2 Add 1000 µL of TRI-Reagent to each sample with one 5mm steel bead and disrupt using the TissueLyser set at 25 Hz in two, 5-minute cycles, rotating racks between cycles.
6.1.3 Incubate samples at room temperature for 15 minutes to allow for viral inactivation.
6.2 Swab and BALF Supernatant Samples (or other liquid samples)
6.2.1 Remove sample from frozen storage. Add 1000 µL of TRI reagent to 300µL of sample. Volumes may be scaled as long as ratios are maintained. The samples do not need be maintained frozen once in TRI reagent.
6.2.2 Mix samples well by vortexing or shaking in a rack on plate shaker.
6.2.3 Incubate samples at room temperature for 15 minutes to allow for viral inactivation.
7. RNA ISOLATION PROCEDURES
Before beginning, ensure that Direct-Zol RNA Prewash, RNA Wash Buffer and DNAse I have been prepared per the manufacturer’s directions. Perform the purification procedure at room temperature (18 to 25ºC), unless otherwise stated.
7.1 Direct-Zol 96 Procedure
7.1.1 Thoroughly clean all counter tops and non-sterile supplies with ELIMINase, or equivalent reagent, prior to use.
7.1.2 Centrifuge homogenates at 10,000-16,000 x g for 5 minutes.
7.1.3 Transfer 400µL of tissue homogenate or liquid sample to a clean collection plate. Store remaining sample at -80ºC.
7.1.4 Add an equal volume of ethanol to sample lysed in TRI Reagent (or equivalent) and mix well by pipetting up and down or using a plate shaker.
7.1.5 Transfer each mixture to a discrete well of Zymo-Spin I-96 plate mounted on a new collection plate and centrifuge at ≥2500 x g for 5 minutes at room temperature. Note: well capacity is 800µL. Spin and reload plate to process larger volumes.
7.1.6 Mount the Zymo-Spin I-96 Plate onto a new collection plate and discardthe flow through.
7.1.7 Add 400µL RNA Wash Buffer to each well of the plate and centrifuge at ≥2500 x g for 5 minutes at room temperature.
7.1.8 Prepare DNAse I according to the following table. Prepare at least 10% excess.
Component | Volume per sample |
DNAse I | 5µL |
DNA Digestion Buffer | 35 µL |
Total Volume | 40µL |
7.1.9 Add 40µL of prepared DNAse I and DNA Digestion Buffer Mix directly to the column matrix of each well.
7.1.10 Incubate at room temperature for 15 minutes.
7.1.11 Add 400µL Direct-zol RNA PreWash to each well and centrifuge at ≥2500 xg for 5 minutes at room temperature.
7.1.12 Discard flow through and wash a second time with 400µL Direct-zol RNA PreWash in each well.
7.1.13 Centrifuge at ≥2500 x g for 5 minutes at room temperature and discard flow through.
7.1.14 Add 800µL RNA Wash Buffer to each well and centrifuge at ≥2500 x g for 5 minutes at room temperature.
7.1.15 Discard flow through.
7.1.16 To ensure complete removal of wash buffer centrifuge the empty plate at ≥2500 x g for 5 minutes at room temperature.
7.1.17 Mount Zymo-Spin I-96 plate onto an Elution Plate.
7.1.18 Add 100µL of DNAse/RNAse free water to each well and centrifuge at ≥2500 x g for 5 minutes at room temperature to elute RNA.
7.1.19 Store the purified nucleic acid on ice for same day use, at -20ºC for up to 1 month, or at -80ºC for long-term storage.
7.2 Direct-Zol 96 Mag Bead Procedure
Before beginning, ensure that MagBead DNA/RNA Wash 1, MagBead DNA/RNA Wash 2 and DNAse I have been prepared per the manufacturer’s directions. Perform the purification procedure at room temperature (18 to 25ºC), unless otherwise stated.
7.2.1 Thoroughly clean all counter tops and non-sterile supplies with ELIMINase,or equivalent reagent, prior to use.
7.2.2 Centrifuge homogenates at 10,000-16,000 x g for 5 minutes for tissue andfeces and 1 min for liquid samples.
7.2.3 Transfer 400µL of tissue homogenate, feces homogenate, or liquid sample to a clean King Fisher Deep Well plate. Store remaining sample at -80ºC.
7.2.4 Add equal volume of ethanol (95-100%) to each sample.
7.2.5 Add 20µL MagBinding Beads to each sample. Seal plate and set aside until ready to load into the KingFisher Flex.
7.2.6 Add 500µL of DNA/RNA Wash 1 (previously diluted according to manufacturer’s instructions) to each sample well in a KingFisher Deep Well Plate. Label appropriately and set aside until ready to load into the KingFisher Flex.
7.2.7 Add 500µL of DNA/RNA Wash 2 (previously diluted according to manufacturer’s instructions) to each sample well in a KingFisher Deep Well Plate. Label appropriately and set aside until ready to load into the KingFisher Flex.
7.2.8 Prepare four ethanol plates. Add 500 µL100% Ethanol to each sample well in a KingFisher Deep Well Plate. Label appropriately (Ethanol 1-4) and set aside until ready to load into the KingFisher Flex.
7.2.9 Prepare DNase Treatment Plate. Add 50 µL of DNase I Reaction Mix (previously prepared according to manufacturer’s instructions) to each sample well in a KingFisher Deep Well Plate. Label appropriately and set aside until ready to load into the KingFisher Flex.
7.2.10 Prepare elution plate. Add 100 µL DNase/RNase free water to each sample well in a KingFisher Elution Plate. Label appropriately, seal plate and set aside until ready to load into the KingFisher Flex.
7.2.11 Select program “R2101_Direct-zol RNA_KingFisherFlex_DNase” on King Fisher Flex.
7.2.12 Load the plates into the KingFisher Flex according to the prompts.
7.2.13 Press Start to begin the run.
7.2.14 When prompted, remove the DNase Treatment plate from the King Fisher Flex and add 500 µL RNA Prep Buffer to each sample well and return plate to King Fisher Flex. Press start to resume run.
7.2.15 When prompted, remove the sample plate from the King Fisher Flex. Remove seal from elution plate and place in the King Fisher Plate. Press Start to resume run.
7.2.16 When run is complete remove elution plate and seal immediately. Store the purified nucleic acid on ice for same day use, at -20ºC for up to 1 month, or at -80ºC for long-term storage.
7.2.17 Follow prompts to remove all plates from KingFisher Flex and discard.
8. RNA QUANTIFICATION PROCEDURES
NOTE: If downstream quality of extracted sample is in question, sample may be analyzed for concentration and quality using spectroscopy instruments (NanoDrop, SpectraMax i3x, Bio-Tek FLx800 or equivalent), or re-extracted. Below are the instructions for the NanoDrop.
8.1 Remove the extracts from storage and maintain cold on the benchtop.
8.2 Clean NanoDrop with ~2 µL of nuclease-free water. Remove with Kim Wipe. Set up NanoDrop 2000 for concentrations presented in ng/µL.
8.3 Blank the instrument with appropriate diluent. Remove blank before reading samples with a Kim Wipe.
8.4 Read ~2µL of the first sample. Label the sample as noted in the “NanoDrop Read Key” above. Save the workbook in the electronic study folder with at the least the following information: [study number – (tech initials and date)]
8.5 Remove the sample from the pedestal with a Kim Wipe after each reading. Continue reading samples (see “NanoDrop Read Key” for number of replicates per sample type) with removing of the previous sample after each reading.
8.6 Highlight all samples and review the report. Ensure the 260/280, 260/230, instrument information, software, and firmware information are included. Set graphs to “overlay”.
8.7 Export the data file and save to the electronic study file and print the report.
8.8 Clean NanoDrop with ~2µL of nuclease-free water. Remove with Kim Wipe.
8.9 Return sample(s) to appropriate storage.
9. REAL-TIME QUANTITATIVE PCR PROCEDURES
9.1 Master Mix Preparation:
9.1.1 Clean the Master Mix PCR Workstation and any non-sterile supplies with ELIMINase, or equivalent reagent, prior to use.
9.1.2 Transfer ~3mL of DNAse/RNAse free water into DNAse/RNAse free 5 mL tube for use during preparation.
9.1.3 Remove N gene and two E gene assays from storage and allow to thaw. Vortex vigorously and centrifuge until liquid is collected at the bottom of the tube.
9.1.4 Remove Taqman® Fast Virus1-Step Master Mix,TaqPath 1-Step Multiplex Master Mix or equivalent from storage and allow to thaw. Swirl or invert the bottle before use.
9.1.5 Use the “Master Mix Preparation” excel worksheet to calculate the amount of each master mix to prepare based on the number of samples to be analyzed.
9.1.6 Prepare required master mix in an appropriately sized PCR clean tube according to the Tables below.
| Master Mix with N gene and Sarbeco E gene Assays for Standard Curve | |||
Reagent | Stock Conc. | Vol. for Single Reactiona | Final Concentration per Reaction |
TaqMan Fast Virus 1-Step Master Mix TaqPath 1 Step Multiplex Master Mix or equivalent |
4X |
5 µL |
1X |
| N gene Assay Mix: | premixed | 1.5 µL | 1X |
| Sarbeco E gene Assay Mix: | premixed | 1.5 µL | 1X |
| DNase/RNase Free Water | N/A | 8.5 µL | N/A |
| Master Mix Total Volume per Well | 15 µL | ||
| RNA, Standard, or Control Sample Amount per Well | 5 µL | ||
| Reaction Total Volume per Well | 20 µL | ||
aNote: Preparation of additional material of master mix (e.g. 10%) is recommended to account for loss during manipulations.
| Master Mix with N gene and sgRNA Leader E gene Assay for Samples | |||
Reagent | Stock Conc. | Vol. for Single Reactiona | Final Concentration per Reaction |
TaqMan Fast Virus 1-Step Master Mix TaqPath 1 Step Multiplex Master Mix or equivalent |
4X |
5 µL |
1X |
| N gene Assay Mix: | premixed | 1.5 µL | 1X |
| sgRNA Leader Assay Mix: | premixed | 1.5 µL | 1X |
| DNase/RNase Free Water | N/A | 8.5 | N/A |
| Master Mix Total Volume per Well | 15 µL | ||
| RNA, Standard, or Control Sample Amount per Well | 5 µL | ||
| Reaction Total Volume per Well | 20 µL | ||
aNote: Preparation of additional material of master mix (e.g. 10%) is recommended to account for loss during manipulations.
9.1.7 Vortex master mix solution to mix well. Transfer prepared master mix solution to PCR workstation or epMotion liquid handler workspace.
9.1.8 Aliquot the nuclease-free water diluent for the standard curve and the controls according to the following preparation table. Alternatively, this step may be performed by epMotion liquid handler.
9.2 Standard Calibration Curve and Quality Control Preparations:
9.2.1 Clean the PCR Workstation and non-sterile supplies with ELIMINase, or equivalent reagent, prior to use.
9.2.2 Remove the SARS-CoV-2 N gene and E gene RNA (1.0 x 109 copies/µL) from frozen storage and allow to thaw.
9.2.3 Aliquot the nuclease-free water diluent for the standard curve and the controls according to the “Standard Calibration Curve and Controls” table.
9.2.4 Serially dilute the SARS-CoV-2 N gene and E gene RNA (1.0 x 109 copies/µL) to create the standard calibration curve samples according to the “Standard Calibration Curve and Controls” table. Alternatively, this step may be performed by epMotion liquid handler.
9.2.5 Prepare assay controls according to the “Standard Calibration Curveand Controls” table.
9.2.6 All calibrators and controls must be prepared on the day of use.
| Standard Calibration Curve and Controls | |||||
Standard Name | RNA Concentration (copies/µL) | Diluent Volume (µL) | Source Volume (µL) |
Source | Source Conc. (copies/µL) |
Standard 1 |
5 x 107 |
180 | 10 (per RNA standard) | SARS-CoV-2 N gene/Egene RNA (1.0 x 109copies/µL) |
1.0 x 109 |
Standard 2 | 5 x 106 | 90 | 10 | Standard 1 | 5 x 107 |
Standard 3 | 5 x 105 | 90 | 10 | Standard 2 | 5 x 106 |
Standard 4 | 5 x 104 | 90 | 10 | Standard 3 | 5 x 105 |
Standard 5 | 5 x 103 | 90 | 10 | Standard 4 | 5 x 104 |
Standard 6 | 5 x 102 | 90 | 10 | Standard 5 | 5 x 103 |
Standard 7 | 5 x 101 | 90 | 10 | Standard 6 | 5 x 102 |
Standard 8 | 5 x 100 | 90 | 10 | Standard 7 | 5 x 101 |
| Positive AmplificationControl- SARS-CoV-2 RNA | 1 x 104 | 80 | 20 | Standard 4 | 5 x 104 |
No Template control | N/A | 100 | 0 | TE Buffer | N/A |
9.3 PCR Plate Preparation
9.3.1 PCR plate preparation may be performed manually in a clean PCR workstation or using the epMotion liquid handler.
9.3.2 Add 15.0 µL of master mix into appropriate sample wells of a PCR plate; refer to plate map.
9.3.3 Add 5 µL of the RNA extracts to the designated wells for study samples; refer to plate map
9.3.4 Add 5 µL of the controls to the designated wells; refer to plate map.
9.3.5 Add 5 µL of TE Buffer to the designated “NTC” wells; refer to plate map.
9.3.6 Seal the PCR plate as appropriate to the plate type.
9.3.7 Spin the plate briefly using the plate spinner until bubbles at the bottom of the wells are absent. Ensure there are no smears on the caps or seal beforeplacing the plate on the Stratagene MX3005P or BioRad CFX384 Touch instrument.
9.3.8 Analyze the extracts on the Stratagene MX3005P or BioRad CFX384 Touch instrument using the defined instrument settings.
10. SYSTEM SUITABILITY
Each assay plate will be analyzed independently. The quantification cycle (Cq) set for one plate may not necessarily apply to another without review of the amplification results. System suitability and therefore plate acceptance will be assessed by a series of samples on each plate: a standard calibration curve, a positive control (PC), and a no template control (NTC) containing TE Buffer. For an assay to be accepted the following system suitability criteria must be met:
10.1 Standard calibration curve must have a slope between -3.6 and -3.1, and a best fit line with an R2 value ≥0.98. At least six concentrations including the highest concentration and the LLOQ must be used in analyzing the standard curve.
10.2 Positive control wells must amplify with a log10 transformed calculated value ± 15% of the target value.
10.3 No Template Control must not amplify or amplify with an average Cq value greater than the average Cq value of the LLOQ wells.
11 DATA ANALYSIS
Summary results from the PCR run will be exported to a suitable Excel data file for reporting.
A semi-logarithmic calibration curve is obtained by plotting the Cq values against the logarithm of RNA concentration. The mathematical equation and the parameters characterizing the semi-log curve fitting are as follows:
y = A + B [log(x)]
Where:
y = response variable (Cq value)
x = concentration of analyte
A = y - intercept
B = slope
12. FORMS
The following form templates will be used during method validation and study sample analysis. These forms are subject to change to accommodate updates in the method.
13. REVISION HISTORY
Current Version | Description of Change(s) | Supersedes |
MBM-1387-0 | Initial | None |
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link