mib1_ta52b 4 primer genotyping protocol

4 primer PCR for the genotyping of Mib[ta52] & WT chromosomes

Aim:

Determine the presence of Mib[ta52] and WT alleles in a single PCR reaction.

Caveat: In some genetic backgrounds (e.g. our TLs) the WT allele does not amplify properly using this protocol. This has to be checked beforehand!!!

This PCR is done with three primers:

Mib4P genP5 (8-54, generic forward primer for the Mib[ta52] amplicon):

5’- ACAGTAACTAAGGAGGGC -3’ 

Mib4P WT rv (8-55, specific reverse primer for the Mib WT allele):

  5’- AGATCGGGCACTCGCTCA -3’ 

Mib4P MUT fw (8-56, specific forward primer for the Mib[ta52] allele):

 5’- TCAGCTGTGTGGAGACCGCAG -3’ 

Mib4P genP3 (8-57, generic reverse primer for the Mib[ta52] amplicon):

5’- CTTCACCATGCTCTACAC -3’ 

Primers 8-54 & 8-57 amplify a 705 bp fragment for all genotypes (in theory, actually practically this band is most often barely visible).

Primers 8-54 & 8-55 amplify a 303 bp fragment for fish carrying the WT allele.

Primers 8-56 & 8-57 amplify a 402 bp fragment for fish carrying the Mib[ta52] allele.

Assemble 25 µl PCR reactions:

First add into each tube 2 µl undiluted DNA from NaOH or ProteinaseK digestion.

Then add 23 µl of ice-cold PCR mix:

5 µl Promega GoTaq Flexi Green Buffer

1.5 µl MgCl₂  from GoTaq G2 kit (25 mM stock)

0.5 µl dNTP (from mix with each dNTP at 10 mM)

0.5 µl Primer 8-54 (from 10 µM stock)

0.5 µl Primer 8-55 (from 10 µM stock)

0.5 µl Primer 8-56 (from 10 µM stock)

0.5 µl Primer 8-57 (from 10 µM stock)

0.125 µl Promega GoTaq G2 polymerase

13.875 µl H2O

PCR Program:

Heated lid 105°

Final extension 5 min 72°

Final hold 10°C 

Run 12.5 µl of the PCR reaction on a 2% agarose gel.