Advanced Search
Last updated date: Mar 2, 2022 Views: 662 Forks: 0
1. Amplification of TPM3 gene
I used Human Skeletal Muscle QUCIK-CloneTM cDNA (TaKaRa, Japan) as template and by polymerase chain reaction to amplify the TPM3 gene with TPM3-F (5' ATGGCTGGGATCACCACC 3') and TPM3-R (5' CTACATCTCATTCAGGTCAAGCAG 3') primers by the PCR condition listed below:
Initial Denaturation 94°C for 5 minutes
Denaturation 94°C for 30 seconds
Annealing 56°C for 30 seconds
Extension 72°C for 1 minutes
Repeat 25 cycles
Final Extension 72°C for 7 minutes
2. Gateway cloning
To generate pME-TPM3, product of TPM3 gene was amplified with the primers attB1-TPM3-F (5' GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGCTGGGATCACCACC 3') and attB2-TPM3-R (5' GGGGACAAGTTTGTACAAGAAAGCTGGGTCTACATCTCATTCAGGTCAAGCAG 3') primers by the PCR condition listed below:
Initial Denaturation 94°C for 5 minutes
Denaturation 94°C for 30 seconds
Annealing 58°C for 30 seconds
Extension 72°C for 1 minutes
Repeat 25 cycles
Final Extension 72°C for 7 minutes
After PCR amplification, the product was purified by MinElute PCR Purification kit (Qiagen, Germany). Using Gateway system BP reaction (Invitrogen, US) to generate pME-TPM3(WT). The final expression construct pTol2-MLC2:TPM3(WT):pA/CG2 was generated by Gateway system LR reaction (Invitrogen, US) using p5E-MLC2, pME-TPM3(WT), p3E-polyA and pDestTol2CG2 vector. After LR recombination reaction, the DNA sample was added into TOP10 competent cells for 30 minutes on ice for the transformation. Transferred the sample to 42 °C water bath for 60 seconds for heat shock transformation. After heat shock transformation, the sample was transferred to ice for 5 minutes immediately. 1 mL of LB broth was added and incubated for 1 hour at 37 °C. Then, bacteria were spread on LB agar containing ampicillin and cultured for 16 to 18 hours at 37 °C. Finally, check the clone by using colony PCR and entrusted DNA Sequencing Core Lab in National Health Research Institute to sequence to confirm the clone sequence. The primers used to confirm the LR recombination reaction colony PCR were listed below:
Primer Name | Sequence (5’ to 3’) | Size (bp) |
MLC2-F2 | CCATCACTTTCCCCCTACCT | 805 |
TPM3-R2 | CGGTCCAGCTCTTCTTCAAC | |
TPM3-F2 | AGCCAAGCTGGAAAAGACAA | 340 |
p3E-polyAR | CCCCCTGAACCTGAAACATA | |
MLC2-F2 | CCATCACTTTCCCCCTACCT | 1172 |
p3E-polyAR | CCCCCTGAACCTGAAACATA |
pME-TPM3(E151A) and pME-TPM3(E151G) were created by site-direct mutagenesis (protocol as below) from pME-TPM3(WT). The final expression construct pTol2-MLC2:TPM3(E151A):pA/CG2 was generated by Gateway system LR reaction (Invitrogen, US) using p5E-MLC2, pME-TPM3(E151A), p3E-polyA and pDestTol2CG2 vector. The final expression construct pTol2-MLC2:TPM3(E151G):pA/CG2 was generated by Gateway system LR reaction (Invitrogen, US) using p5E-MLC2, pME-TPM3(E151G), p3E-polyA and pDestTol2CG2 vector.
The sequence of pTol2-MLC2:TPM3(WT):pA/CG2, pTol2-MLC2:TPM3(E151A):pA/CG2 and pTol2-MLC2:TPM3(E151G):pA/CG2 constructs were confirmed.
3. Site-directed mutagenesis
I used QuickChange II site-directed mutagenesis (Agilent Technologies, US) to create the mutation of TPM3 nucleotide 452 mutated from A to C and G. Using TPM3(WT) as template, and TPM3 A452S-F and TPM3 A452S-R as primers, I changed the nucleotide 452 from A to C. Using TPM3(WT) as template, and TPM3 A452G-F and TPM3 A452G-R as primers, I changed the nucleotide 452 from A to G. The sequence of those primers were listed below.
Primer Name | Sequence (5’ to 3’) |
TPM3 A452S-F | CTGAGCTGGCAGSGTCCCGTTGCCG |
TPM3 A452S-R | CGGCAACGGGACSCTGCCAGCTCAG |
TPM3 A452G-F | CTGAGCTGGCAGGGTCCCGTTGCCG |
TPM3 A452G-R | CGGCAACGGGACCCTGCCAGCTCAG |
The reaction components and condition was listed below:
Reaction mix
10X reaction buffer 5 µL
DNA template (5-50 ng) X µL
Forward primer (10 µM) 1.25 µL
Reverse primer (10 µM) 1.25 µL
dNTP mix 1 µL
PfuUltra polymerase (2.5 U/µL) 1 µL
Nuclease-free water 40.5-X µL
PCR protocol
Segment 1 95°C for 30 seconds
Segment 2 95°C for 30 seconds
68°C for 1 minute
68°C for 3.5 minutes
Repeat 12 cycles
Segment 3 4°C for 2 minutes
After PCR, 1 µL of Dpn I was added and incubated for 1 hour at 37 °C to digestion the amplification products. Then, 1 µL of Dpn I -treated DNA sample was added into XL1-Blue supercompetent cells and incubated on ice for 30 minutes. The sample was transferred to 42 °C water bath for 60 seconds for heat shock, then immediately transferred to ice for 5 minutes. 1 mL of LB broth was added and incubated at 37 °C for 1 hour. Then, bacteria were spread on LB agar containing kanamycin and cultured at 37 °C for 16 to 18 hour. Finally, the clones were checked by colony PCR and the DNA was extracted and sent to Sequencing Core Lab in National Health Research Institute for sequencing to confirm the clone.
4. Embryos collection
Embryos can be collected once a week with best results on a regular schedule. The night before embryo collection, adult male and female zebrafish were placed into mating tank with a clapboard after the last feeding. Next morning, the clapboard was removed to start mating. Embryos were collected after 1 hour, removed the dead and unfertilized embryos. Transfer healthy embryos to a clean petri dish containing E3 medium. Keep the embryos in the incubator at 28 °C.
E3 medium:
NaCl (AMRESCO, US) 5 mM
KCl (AMRESCO, US) 0.17 mM
CaCl2(J.T.Baker, US) 0.33 mM
MgSO4(J.T.Baker, US) 0.33 mM
5. Microinjection
Preparation the needle with a micropipette puller, pull a glass capillary into two needles. Inserted the needle into the Nanoject IITM Nanoliter injector (Drummond Scientific, US). For DNA and RNA co-injection, injected 2.3 nL contained 0.05% phenol red into an embryo at one-cell stage. Ensured the embryos did not develop past the two-cell stage. After injection, embryos were placed in E3 medium and incubated at 28°C.
6. Selection and confirmation of transgenic zebrafish
Two days after microinjection, used fluorescent microscope to screen the heart of zebrafish embryo have green fluorescent or not. When the transgenic zebrafish were 3 months old, DNA was extracted by cutting the fins. After amplification the target fragment by polymerase chain reaction, we entrusted DNA Sequencing Core Lab in National Health Research Institute to sequence to confirm the target sequence. The primers used for sequencing were listed in below:
Primer Name | Sequence (5’ to 3’) | Size (bp) |
TPM3-NF | GATGAAGAAAAGATGGAACTCCAGG | 447 |
TPM3-R | CTACATCTCATTCAGGTCAAGCAG |
Category
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link