Advanced Search
Last updated date: Jan 23, 2022 Views: 766 Forks: 0
RNA aptamers are rapidly gaining interest as targeting moieties for drug delivery due to their easy production and scalability, high affinity and specificity, lack of immunogenicity, and deep tissue penetration properties. Determination of the in vivo distribution of aptamers is essential to evaluate their performance and develop efficient delivery protocols. Many techniques that are currently used to perform biodistribution studies as optical imaging, magnetic resonance (MR), or nuclear medicine (as PET and SPECT) can be applied to the study of aptamers but require either the use of radioactive nucleotides or coupling the aptamers with the imaging probe de facto altering the pharmacokinetic and the biodistribution of the aptamer. These strategies often need dedicated and expensive instruments and/or the use and disposal of radioactive material. Here we describe a sensitive and safe method based on qRT-PCR for the ex vivo quantification of unmodified aptamers in tissues.
Detection and quantification of aptamer in mouse tissues by qRT-PCR
Serena Zilio1, Paolo Serafini1,2*
1 Department of Microbiology and Immunology, Sylvester Comprehensive Cancer Center, University of Miami, Miller School of Medicine, Miami, FL 33136, USA.
2 Department of Otolaryngology, Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL 33136, USA.
*For correspondence: pserafini@med.miami.edu
RNA aptamers are rapidly gaining interest as targeting moieties for drug delivery due to their easy production and scalability, high affinity and specificity, lack of immunogenicity, and deep tissue penetration properties. Determination of the in vivo distribution of aptamers is essential to evaluate their performance and develop efficient delivery protocols. Many techniques that are currently used to perform biodistribution studies as optical imaging, magnetic resonance (MR), or nuclear medicine (as PET and SPECT) can be applied to the study of aptamers but require either the use of radioactive nucleotides or coupling the aptamers with the imaging probe de facto altering the pharmacokinetic and the biodistribution of the aptamer. These strategies often need dedicated and expensive instruments and/or the use and disposal of radioactive material. Here we describe a sensitive and safe method based on qRT-PCR for the ex vivo quantification of unmodified aptamers in tissues.
Keywords: Quantification, Aptamers, qRT-PCR, Tissue, Aptamer Biodistribution.
RNA aptamers or “chemical antibodies” are single-stranded DNA or RNA oligonucleotides capable of binding their cognate target with high affinity and specificity because of their three-dimensional structure (Hu 2016, Parashar 2016, Qu, Yu et al. 2016, Sullenger and Nair 2016).These short chemically synthesized molecules are not immunogenic and penetrate deeply into the tissue. The fluorinated backbone of aptamers makes them resistant to RNAse degradation and incapable of triggering Toll-like Receptor (TLR) signaling (Ulrich, Martins et al. 2004, Zhu, Ye et al. 2012). Aptamers are isolated by Systematic Evolution of Ligands by Exponential enrichment (SELEX), a process in which a random library of aptamers (~1015 molecules) is partitioned using positive and negative selectors. During Cell- SELEX, aptamers are selected for internalization by receptor- or clathrin-mediated endocytosis (Farokhzad, Jon et al. 2004, Chu, Twu et al. 2006, McNamara, Andrechek et al. 2006, Magalhaes, Byrom et al. 2012, Thiel, Bair et al. 2012). This procedure allows the selected aptamer to deliver therapeutics intracellularly, allowing specific uptakes on the target cells. Last, the combinatorial use of aptamers, each binding a different epitope in the target cell, increases the overall specificity and maximizes drug delivery in the chosen tissue (De La Fuente, Zilio et al. 2020). Because of these qualities, RNA aptamers are attracting growing interest in the biomedical field for imaging and for the targeted delivery of therapeutics, allowing for higher efficacy and lower side effects.
An accurate determination of aptamer biodistribution is crucial for preclinical development and for performing IND enabling studies (Kunjachan, Ehling et al. 2015). Aptamer biodistribution studies are performed using techniques initiallylly developed for inorganic and organic compounds such as drugs, nanoparticles, or antibodies. These techniques employ, for example, immunohistochemistry, liquid scintillation counting (LSC), in vivo optical imaging, computed tomography (CT), magnetic resonance imaging (MRI),and nuclear medicineimaging techniques (Arms,Smith et al. 2018) and require aptamer modifications and specialized instruments. Additionally, these techniques are expensive, require expertise, and often involve modifying aptamer’s structure that can alter their biodistribution. Although in vivo imaging techniques (i.e. IVIS, PET, and SPECT) allow longitudinal studies and good probe quantification they are often limited by low tissue penetrance and/or spatial resolution (Arms, Smith et al. 2018). In this protocol, we described a simple, cost-effective, non-radioactive method that allows quantifying aptamers in tissues precisely. This strategy employed the aptamers’ constant region and a simple technique based on RNA extraction and qRT-PCR that most laboratories commonly use.
| Table 1. Aptamer sequences | |
| Aptamer | Sequence 5’-3’ |
| Aptamer 3 | 5’GGAGGACGAUGCGGAUUACCAACUUGAACGCCGAGAGUGUGGUCACGUG UUCUGCAGACGACUCGCUGAGGAUCCGAGA3’ |
| Aptamer 6 | 5’GGAGGACGAUGCGGCAGGUGCGGGAUCUAAUGCGUAGACAGCCAUAUAC UGACACAGACGACUCGCUGAGGAUCCGAGA3’ |
| Aptamer 11 | 5’GGAGGACGAUGCGGGGAAGCAACACUUAGUCGCGAUUGAUACGUGCGCA GUCAUCAGACGACUCGCUGAGGAUCCGAGA3’ |
| Aptamer 14 | 5’GGAGGACGAUGCGGUGUACACUGAUUGCCUUUGUGUUAUGAGCGACAGA UCUGCCAGACGACUCGCUGAGGAUCCGAGA3’ |
| SUL 5’: | 5’-GGGGGAATTCTAATACGACTCACTATAGGGAGGACGATGCGG-3’ |
| SUL3’: | 5’-TCTCGGATCCTCAGCGAGTC-3’ |
Notes: (*) This protocol refers to aptamers generated using the constant regions defined by the Sullenger group (Layzer and Sullenger 2007).Please use primercorresponding to the constant regionof your aptamers.
A. Tissue preparation
Note: To perform a biodistribution study in addition to the target-specific organ/s (e.g. tumor), the analysis of spleen, lung, liver, kidney, and heart is recommended. Important: use tissue from PBS injected animals as negative controls.
B. RNA extraction
C. Amplification
RNA quantification and dilution
Standard curve preparation (range 11 fM-1.5 µM)
Amplification by qRT-PCR
| Table 2. Reaction Buffer Setup (*) | ||
Component | Volume for 20ul Reaction | Final Concentration |
| iTaq universal SYBR® Green reaction mix (2x) | 10 ul | 1x |
| iScript reverse transcriptase | 0.25 ul | 1x |
| 10 µM Primer SUL 5’ | 0.6 | 0.3 µM |
| 10 µM Primer SUL 3’ | 0.6 | 0.3 µM |
| RNA (add at step 8) | 2 | 100 ng (**) |
| Nuclease-Free H2O | 6.55 | -- |
| Total reaction mix volume | 20 | --- |
Calculate the numberof reactions that need to be performed, consider performing triplicates (suggested) or duplicates of each sample, standard curve points, and no-template controls
| Table 3. Thermal cycling Protocol (***) | |||
Component | Temperature | Duration | |
| Reverse transcription reaction | 50°C | 50’ | |
| Polymerase activation and DNA denaturation | 95°C | 5’ | |
Amplification 30 cycle | Denaturation | 95°C | 5’’ |
| Annealing | 53°C | 15’’ | |
| Extension/Plate Read | 72°C | 60’’ | |
Notes: (*) Primers and their concentration must be experimentally defined and validated according to experimental need. Primer volume, RNA volume, and water volume can be adapted according to experimental conditions. (**) The quantity of RNA per test may vary depending on the test limit of detection and aptamer distribution in different organs. An appropriate amount of starting RNA per tissue should be experimentally tested. In this protocol, 100 ng of RNA has been used per reaction. (***) Thermal cycling protocol need to be adapted according to experimental need and experimentally validated
Microsoft Excel or equivalent software can be used to calculate the RNA yield and analyze raw RT- qPCR amplification data. Systat Sigmaplotor equivalent softwarecan perform statistical analysis using the analysis of variance (one-way ANOVA) method (*).
Notes: The limit of detection of our qRT-PCR is estimated at 0.03 fmol of aptamer in 300 ng of total RNA (~3000 to 26,000 aptamer molecules/ μg of tissue). (*) The statistical method may vary depending on the experimental need
This work is supported by the DOD-BRCA idea award W81XWH-11-1-0478, the NIDDK-supported Human Islet Research Network (HIRN, RRID:SCR_014393; https://hirnetwork.org; UC4 DK 116241the NIH award, and a JDRF award to Paolo Serafini.
The original research paper for the above aptamer quantification protocol has been published in: A.De La Fuente, S.Zilio, J.Caroli, D.Van Simaeys, E.M.C. Mazza, T.A. Ince, V.Bronte, S.Bicciato, D.T. Weed, P.Serafini, Aptamers against mouse and human tumor-infiltrating myeloid cells as reagents for targeted chemotherapy. Sci. Transl. Med.12, eaav9760 (2020). https://www.science.org/doi/10.1126/scitranslmed.aav9760
S.Z. and P.S. are named as inventors in nonprovisional US patent application no. 62/815,142 entitled “RNA aptamer and uses thereof,” filed by the University of Miami, regarding the use of RNA aptamer to target myeloid cells. P.S. is co-founder of wink-therapeutics for the use of RNA aptamers.
Ethics: All animal experiments were approved by the Division of Veterinary Resources and the Institutional Animal Care and Use Committee (IACUC) of the University of Miami.
Arms, L., D. W. Smith, J. Flynn, W. Palmer, A. Martin, A. Woldu and S. Hua (2018). "Advantages and Limitations of Current Techniques for Analyzing the Biodistribution of Nanoparticles." Front Pharmacol 9: 802.
Arms, L., D. W. Smith, J. Flynn, W. Palmer, A. Martin, A. Woldu and S. Hua (2018). "Advantages and Limitations of Current Techniques for Analyzing the Biodistribution of Nanoparticles." Frontiers in pharmacology9: 802-802.
Chu, T. C., K. Y. Twu, A. D. Ellington and M. Levy (2006). "Aptamer mediated siRNA delivery." NucleicAcids Res 34(10): e73.
De La Fuente, A., S. Zilio, J. Caroli, D. Van Simaeys, E. M. C. Mazza, T. A. Ince, V. Bronte, S. Bicciato, D. T. Weed and P. Serafini (2020). "Aptamers against mouse and human tumor-infiltrating myeloid cells as reagents for targeted chemotherapy." Sci Transl Med 12(548).
Farokhzad, O. C., S. Jon, A. Khademhosseini, T. N. Tran, D. A. Lavan and R. Langer (2004). "Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells." Cancer Research 64(21): 7668-7672.
Hu, P. P. (2016). "Recent Advances in Aptamers Targeting Immune System." Inflammation. Kunjachan, S., J. Ehling, G. Storm, F. Kiessling and T. Lammers (2015). "Noninvasive Imaging of Nanomedicines and Nanotheranostics: Principles, Progress, and Prospects." Chem Rev 115(19): 10907-10937.
Layzer, J. M. and B. A. Sullenger (2007). "Simultaneous generation of aptamers to multiple gamma- carboxyglutamic acid proteins from a focused aptamer library using DeSELEX and convergent selection." Oligonucleotides17(1): 1-11.
Magalhaes, M. L., M. Byrom, A. Yan, L. Kelly, N. Li, R. Furtado, D. Palliser, A. D. Ellington and M. Levy (2012). "A general RNA motif for cellular transfection." Mol Ther 20(3): 616-624.
McNamara, J. O., 2nd, E. R. Andrechek, Y. Wang, K. D. Viles, R. E. Rempel, E. Gilboa, B. A. Sullenger and P. H. Giangrande (2006). "Cell type-specific delivery of siRNAs with aptamer-siRNA chimeras." Nat Biotechnol 24(8): 1005-1015.
Parashar, A. (2016). "Aptamers in Therapeutics." J Clin Diagn Res 10(6): Be01-06.
Qu, J., S. Yu, Y. Zheng, Y. Zheng, H. Yang and J. Zhang (2016). "Aptamer and its applications in neurodegenerative diseases." Cell Mol Life Sci.
Sullenger, B. A. and S. Nair (2016). "From the RNA world to the clinic." Science 352(6292): 1417- 1420.
Thiel, W. H., T. Bair, A. S. Peek, X. Liu, J. Dassie, K. R. Stockdale, M. A. Behlke, F. J. Miller, Jr. and P.
H. Giangrande (2012). "Rapid identification of cell-specific, internalizing RNA aptamers with bioinformatics analyses of a cell-based aptamer selection." PLoS One 7(9): e43836.
Ulrich, H., A. H. Martins and J. B. Pesquero (2004). "RNA and DNA aptamers in cytomics analysis." Cytometry A 59(2): 220-231.
Zhu, G., M. Ye, M. J. Donovan, E. Song, Z. Zhao and W. Tan (2012). "Nucleic acid aptamers: an emerging frontier in cancer therapy." Chem Commun (Camb) 48(85): 10472-10480.
Related files
Detection and quantification of aptamer in tissues by qRT-PCR.pdf Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link