Improve Research Reproducibility A Bio-protocol resource
bpdetail_icon_lock
Preprint

Quantitative RT-PCR

YZ Yang Zhang
HY Huanghe Yang

Last updated date: Jan 11, 2022 Views: 680 Forks: 0

original An abbreviated version of this protocol was published in Science Advances in May, 2020
TMEM16F phospholipid scramblase mediates trophoblast fusion and placental development
download pdf Download PDF
ask Ask a question
cite How to cite
nfavorite Favorite

The TMEM16F qRT-PCR sequence information was missed in our Supplementary Table 2. The following is the sequence information. 


TMEM16F(ANO6)
Forward Primer AAATTGCCTCTGAAACCCAATGA 
Reverse Primer GCTTTCGTCTACACTGAGGACTT

Copyright: Content may be subjected to copyright.
How to cite：
Readers should cite both the Bio-protocol preprint and the original research article where this protocol was used:
  1. Zhang, Y and Yang, H(2022). Quantitative RT-PCR. Bio-protocol Preprint. bio-protocol.org/prep1493.
  2. Zhang, Y., Le, T., Grabau, R., Mohseni, Z., Kim, H., Natale, D. R., Feng, L., Pan, H. and Yang, H.(2020). TMEM16F phospholipid scramblase mediates trophoblast fusion and placental development . Science Advances 6(19). DOI: 10.1126/sciadv.aba0310

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A
This protocol preprint was submitted via the "Request a Protocol" track.