Advanced Search
Last updated date: Jul 14, 2021 Views: 1468 Forks: 0
Microinjections into zebrafish embryos
Introduction
Here we provide a detailed protocol for the zebrafish microinjection procedure used in:
Liu PH, Shah RB, Li Y, Arora A, Ung PM-U, Raman R, Gorbatenko A, Kozono S, Zhou XZ, Brechin V, Barbaro JM, Thompson R, White RM, Aguirre-Ghiso JA, Heymach JV, Lu KP, Silva JM, Panageas KS, Schlessinger A, Maki RG, Skinner HD, de Stanchina E, and Sidi S. An IRAK1-PIN1 signaling axis drives intrinsic tumour resistance to radiation therapy. Nat Cell Biol 21:203-213, 2019.
1. Set up
To line up the embryos, we place a slide onto one side of a 10 mm petri dish (Fisher, #FB0875713). The embryos are placed near the edge of the slide using a polyethylene transfer pipettes (VWR, #16001-188). The embryos can be lined up in one or two columns for injection (Figure 1). Use extended fine tip polyethylene transfer pipettes (Samco Scientific, #14670-339) to remove excess water (do not remove all water). This will help keep embryos in position throughout the procedure.

Figure 1. Schematic of the injection set-up.
2. Stage of injection
Embryos can be injected up to the four-cell stage to ensure uniform morpholino or mRNA distribution, but it is preferable to inject at the one cell stage (see Figure 2 below).
3. Needle preparation
We custom prepare our microinjection needles using the P-97 Flaming/Brown Micropipette Puller (Sutter Instrument Co.), setting the needle pulling parameters as follows:
P=500 (Pressure setting) HEAT=754 PULL=75 (pull strength) VEL.=80 (Velocity) TIME=150 |
Turn on the power and select the program. Loosen both clamping knobs then load a piece of the borosilicate glass (Sutter Instrument Co., #BF 100-50-10, O.D.: 1.00 mm, I.D.: 0.5 mm, 10 cm length) into the puller. Position the glass in the center and tighten down both clamping knobs. Press the <PULL> key. Each procedure will generate two needles. Loosen the clamping knobs and remove the needles from the puller bars. Store needles on top of a small piece of clay in a Petri dish (this will avoid dust accumulation on and in the needles) until use.
4. Injection procedure
We use the NARISHIGE IM 300 Microinjector with the following parameters:
Step1: INJECT Step2: CLR.HOLD Step3: BALANCE Step4: HOLD Step5: FILL Step6: INJECT | Step7: REL.HOLD Step8: CLR.HOLD Step9: REL.BAL Step10: CLEAR Step11: AUTO-SEQ Step12: FILL |
FILL: 26 (~20) psi INJ: 9.6 psi (5-12 psi) BALN: 3.2 psi HOLD: 0.0 -iH2O | |
CLR: 0.5 sec CLRH: 0.4 sec FILL: 0.3 sec INJ: 0.3 sec | |
To limit cellular disruption, we prefer to inject morpholinos and synthetic mRNAs in the yolk in area immediately adjacent to (below) the cytoplasm (Figure 2). The injected solution can be made visible by adding phenol red (Sigma) to working MO or mRNA solution (in which case, adjust dilution volume accordingly). We load 2 mL of mRNA or MO solution (see below) into the needle with a microloader (Eppendorf, Catalog #: 930001007). After injection, place the embryos into a 10 cm Petri dish with egg water and incubate them at 28.5°C.

Figure 2. Schematic of the injection procedure (injection volume to scale).
5. MO/mRNA concentrations:
In the Liu et al. study (Liu et al., Nat Cell Biol 2019), we injected 25 pg (+/- 5 pg) mRNA per embryo. With the Microinjector parameters set as above, the injected volume is approximately 1 nL. Therefore, we worked with mRNA solutions at final concentrations of 25 ng/mL.
For the irak1, irak4 and pin1 MOs, we used 1 mL of a 2 mM stock diluted in 4 mL H2O. These 1:5 dilutions of the stock (0.4 mM final concentration) were the solutions used for injection. Because the injection volume is approximately 1 nl (see above), the MO dose delivered to each embryo was approximately 0.4 pmol. For the myd88 MO, the working concentration was 0.8 mM (1:2.5 dilution) for a final dose of 0.8 pmol injected per embryo.
6. Protocol summary:
Evening prior to the injection:
Day of the injection:
Solutions:
- Egg water: 12g sea salt (Instant Ocean) in 20 L H2O
- 0.1 Methylene blue stock: 100 mg Methylene blue in 100 mL H2O.
Morpholinos used in Liu et al. Nat Cell Biol, 2019:
| Morpholino | Sequence | Working concentration |
| irak1 | AATCCTGCAACACAACAGCCACATT | 0.4 mM |
| irak4 | GTGAACAGGTAAAGCCTCACAGGAT | 0.4 mM |
| pin1 | ACTCTCTCTGCTCACTCTGGATGAG | 0.4 mM |
| myd88 | GTTAAACACTGACCCTGTGGATCAT | 0.8 mM |
Prior to ordering the Mos, it is important to sequence the MO target sequences in the zebrafish stocks used in your laboratory. If SNPs are detected in the genetic background, MO sequences should be changed accordingly.
Category
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link