How to Perform a Tracer Displacement BRET Assay for the TRPML1 Ion Channel

Materials and reagents

Biological materials

1. Human embryonic kidney 293T cells (American Type Culture Collection, CRL-3216)

Reagents

1. Flexi^® cloning system (Promega, catalog number: C8640)

2. hTRPML1 fused to YFP plasmid (Addgene, catalog number: 18826)

3. Plasmid constructs: The gene encoding the full-length human TRPML1 (Uniprot: Q9GZU1) was cloned in frame with nanoluciferase in plasmid pFC32K, part of the Flexi^® cloning system. The coding sequence for hTRPML1 was PCR-amplified from hTRPML1 fused to YFP plasmid using primers hTRPML1-fb003 (GGCTGCGATCGCCATGACAGCCCCGGCGGGTCC) and hTRPML1-rb003 (ATGGGTTTAAACATTCACCAGCAGCGAATGCTCCTCCG). Correct cloning was confirmed by sequencing.

4. Fetal bovine serum (FBS) (Gibco, catalog number: A5256701)

5. FuGENE^® HD transfection reagent (Promega, catalog number: E2311)

6. Nanoluciferase substrate/inhibitor (Promega, catalog number: N2162)

Note: The nanoluciferase substrate (furimazine-based) [31] and inhibitor [32] are both proprietary of Promega Corp, thus the exact composition of the kit is not fully disclosed.

7. Tracer dilution buffer (Promega, catalog number: N2191)

8. MRC087, 10 mM stock in DMSO (self-made, see [33]); validated and deposited in tracerDB (ID T000049; tracerdb.org) [34]

9. Dimethyl sulfoxide (DMSO), molecular biology grade (Sigma-Aldrich, catalog number: D2650-100ML)

10. NucleoBond Xtra Maxi Plus kit (Macherey Nagel, catalog number: 740416.50)

11. DMEM, high glucose (Gibco, catalog number: 11965092)

12. Penicillin-streptomycin (10,000 U/mL) (Gibco, catalog number: 15140122)

13. Dulbecco’s phosphate-buffered saline (PBS) (Sigma-Aldrich, catalog number: D8537-500ML)

14. 0.25% trypsin-EDTA (Gibco, catalog number: 25200072)

15. Trypan Blue solution, 0.4% (Gibco, catalog number: 15250061)

16. Opti-MEM serum-free without phenol red and antibiotics (Gibco, catalog number: 11058021)

Laboratory supplies

1. Cell culture flask, 250 mL, 75 cm² (Greiner, catalog number: 658175)

2. 15 mL centrifuge tube (Corning, catalog number: 430766)

3. 96-well, white-walled/opaque bottom plate (Greiner Bio-One, catalog number: 655098)

4. 125 μL tips, sterile, with filter (Integra, catalog number: 4425)

5. 12.5 μL tips, sterile, with filter (Integra, catalog number: 4405)

6. Neubauer chamber (Cral, catalog number: C1010)

7. Reagent reservoir, 25 mL (Thermo, catalog number: 809311)

8. Aluminum foil

9. 10 mL sterile serological pipette (Sarstedt, catalog number: 86.1254.001)

Equipment

1. Inverted microscope (Leica, model: DMi8)

2. Centrifuge (Eppendorf, model: 5810R) with S-4-104 rotor

3. Plate reader (BMG LABTECH CLARIOstar)

4. Pipette controller (USA Scientific Inc, model: ErgoOne FAST)

5. Multichannel pipette 100 μL (Thermo Fisher Scientific, model: Finnpipette F1)

6. Orbital shaker (Heidolph, model: Titramax 101)

7. Biosafety cabinet (ESCO, model: Airstream AC2-4S8)

Software and datasets

1. GraphPad Prism (GraphPad, Version 11.0.2)

2. tracerDB [34] (tracerdb.org): a crowdsourced database of experimentally validated fluorescent tracers for target engagement assays (last accessed July 2026)

Procedure

A. Cell culture and transfection (perform in a biosafety cabinet)

1. Grow the cells in a T75 flask using DMEM supplemented with 10% FBS and antibiotics (1% penicillin and streptomycin).

Note: This supplemented DMEM medium used for cell culture is also referred to as complete culture medium in this protocol.

2. Once the cells reach 80%–90% confluency, aspirate the cell medium with a sterile 10 mL pipette and add 10 mL of warm (37 °C) PBS.

3. Swirl to wash out the residual culture media. Aspirate the PBS with a sterile 10 mL pipette and add 1 mL of warm (37 °C) 0.25% trypsin-EDTA solution.

4. Place the flask in a 37 °C, 5% CO₂ incubator for 2 min.

Note: Cell viability may be reduced with longer incubation times.

5. Gently swirl the flask to detach cells. Once cells start to slide as patches or show smooth edges under a microscope, add 9 mL of complete culture media to deactivate the trypsin.

6. Pipette up and down to fully dissociate the cells and transfer the cell suspension to a 15 mL sterile centrifuge tube.

7. Centrifuge cells at 210× g for 6 min at 20 °C.

8. Remove the supernatant and suspend cells with 10 mL of complete culture medium.

9. Mix 20 μL of cell suspension with 20 μL of trypan blue and count viable cells using a Neubauer chamber.

10. Dilute cells to 2 × 10⁵ cells/mL with complete culture media.

11. Transfer the cell suspension to a sterile reagent reservoir and add 100 μL of cell suspension per well to a white-walled/opaque-bottom 96-well assay plate using a multichannel pipette.

Note: We recommend 20,000 cells per well for HEK293T. Adjust for other cell types to reach 60%–80% confluency at the time of transfection.

12. Prepare the transfection mix: add 24 μg of plasmid DNA in 1.2 mL of Opti-MEM serum-free without phenol red or antibiotics. Then, add 72 μL of FuGENE^® HD transfection reagent and mix by inversion 10 times. Incubate at room temperature for 10 min.

Notes:

1. This transfection mix is enough for a full 96-well plate.

2. The plasmid DNA was originally purified using the NucleoBond Xtra Maxi Plus kit, which contains RNase A and renders transfection-grade plasmid DNA. See procedures for cloning and purification in [33].

13. Transfer 10 μL of the transfection mix to every well of the assay plate.

14. Place the assay plate in a 37 °C, 5% CO₂ incubator for 48 h.

B. Add compounds to cells and incubate (perform outside a biosafety cabinet)

1. Remove the assay plate from the incubator and carefully wash the cells with 100 μL of warm (37 °C) PBS.

2. Replace the PBS with 85 μL of warm Opti-MEM without phenol red and antibiotics.

3. Prepare the MRC087 tracer mix: aliquot 2 μL of the 10 mM stock solution to a microtube. Then, add 498 μL of tracer dilution buffer (TDB) and mix 10 times.

Critical: Keep the tracer mix protected from light. The tracer mix is prone to degradation under constant light irradiation and may affect the results. For long-term storage, keep it frozen in 100% DMSO at -30 °C until use.

Notes:

1. This tracer mix is enough for a full 96-well plate. Adjust the volume of reagents if only half of the assay plate will be used.

2. Do not mix vigorously to avoid foaming.

4. Prepare the compound dilution solutions: prepare a 10-point serial dilution (starting from 10 mM) of the test compound in DMSO in a 1:2 ratio. The final volume in each well should be 5 μL.

Critical: The 11th and 12th points must be composed of only DMSO, no test compound added.

Notes:

1. The maximum DMSO concentration used in the assay is 1%, after compound and tracer addition.

2. The compound dilution can be prepared in any available plasticware (96-well plate, PCR strip, microtubes, etc.).

5. Dispense 45 μL of Opti-MEM without phenol red and antibiotics to every compound dilution solution and mix it well to ensure homogenization.

6. Transfer 10 μL of the compound dilution solutions to every well of the assay plate, in quadruplicate (Figure 1).

Notes:

1. For a full 96-well assay plate, prepare the serial dilutions for two test compounds.

2. If potent compounds are present, adjust the dilution ratio to 1:3.

3. If dose-response is not needed, adjust the compound and assay plates composition to test up to 20 compounds in quadruplicate.

Figure 1. Schematic representation showing how to prepare the dose-response of one compound in the BRET assay. To ensure that the whole assay plate is used, prepare a second serial dilution of a second test compound in advance.

7. Dispense 5 μL of the tracer (MRC087) mix to every well of the assay plate, with the exception of the 12th column (Figure 2).

Critical: Do not dispense the tracer mix in the 12th column; instead, add only the respective vehicle (5 μL of TDB).

Note: These steps ensure that tracer control will give the maximum signal of the assay, and bank control will only give a nonspecific signal.

Figure 2. Plate layout for a dose-response assay using two unlabeled test compounds (green and yellow circles). The color fades from dark (1st column) to pale (10th column) as the concentration of the compound decreases. Tracer control (red circles, 11th column) and blank control (blue circles, 12th column) are mandatory for the assay. Tracer control is composed of tracer and vehicle (100% signal, no test compound). Blank control is composed of the vehicle (0% signal, no test compound or tracer). Both controls are used for data normalization and Z’-factor determination.

8. Wrap the assay plate in aluminum foil and incubate at 37 °C for 2 h.

Note: This step does not require an incubator with a CO₂ line.

C. Dispense nanoluciferase substrate/inhibitor and read the assay (perform outside a biosafety cabinet)

1. Prepare the nanoluciferase substrate/inhibitor solution: in a 15 mL centrifuge tube, add 5.5 mL of warm (37 °C) Opti-MEM without phenol red, followed by 33 μL of nanoluciferase substrate and 11 μL of nanoluciferase inhibitor. Vortex for 2 min.

Note: This nanoluciferase substrate/inhibitor solution is enough for a full 96-well plate.

Critical: Keep the nanoluciferase substrate/inhibitor protected from light. For long-term storage, keep it frozen at -30 °C until use.

2. Transfer 50 μL of the nanoluciferase substrate/inhibitor solution to every well of the assay plate and wrap it in aluminum foil.

3. Place the assay plate in an orbital shaker at room temperature at 600 rpm for 5 min.

Critical: Nanoluciferase emits stable blue light after 5 min in contact with its substrate up to 2 h. If you read immediately after adding the substrate, the light emissions will overflow the equipment and will decay until it reaches the stable emission phase.

4. Remove the aluminum foil and place the assay plate in the plate reader.

5. Set the light emissions at 460 ± 10 nm and fluorescent emissions at 610 ± 20 nm. Set the integration time to 0.5 s and adjust the gain to 3,600 for both detection channels.

Note: Gain was adjusted to 3,600 (maximum) as it gave the best signal-to-noise in this protocol. The gain may be reduced depending on the plate reader available.

6. Read the assay plate from the top, without the lid.

Data analysis

The number of biological replicates depends on the experiment goal (e.g., screening of large compound libraries or performing dose-response curves). To ensure reproducibility, especially for dose-response curves, we recommend performing at least three independent biological replicates with four technical replicates per experiment. Always include a tracer control in the 11th column (cells with tracer plus vehicle) and a blank control in the 12th column (cells with vehicle only) (Figure 1).

A. Calculate the mili-BRET (mBRET) ratio, also referred to as miliBRET units (mBU)

1. Divide the raw fluorescent emission (610 ± 20 nm) by the raw light emission (460 ± 10 nm) within the same well.

2. Multiply the previous result by 1,000. This gives the miliBRET units (also called mBRET or mBU).

Note: The raw BRET values normally give a fraction of a decimal, as the fluorescence signal is much smaller than the luminescence. To solve this issue, a standard practice is to multiply by 1,000 to generate the miliBRET units (mBRET or mBU) [35].

3. Average the miliBRET units obtained in the tracer control (entire 11th column) and in the blank control (entire 12th column).

4. Normalize the data from each well to the averaged controls. Set the averaged value of the tracer control to 100% signal and the blank control to 0% signal.

Note: Essentially, this is a competition assay (hence, tracer displacement assay) between the fluorescent tracer and the non-fluorescent test compound. You should expect that the higher the compound affinity for the protein, the lower the tracer fluorescence.

B. Plot the data and visualize the curve fit

1. Plot the normalized miliBRET units as a function of test compound concentration in an XY graph using GraphPad Prism v11.0.2.

2. Determine the apparent EC₅₀ (Figure 3) by fitting the data to a four-parameter, no baseline weighting, and no constraints sigmoidal dose–response equation available in GraphPad Prism v11.0.2, where X is the test compound concentration, as shown in equation (I) below:

$\mathrm{(I}\text{) normalized milliBRET units}(\%)={\mathrm{Plateau}}_{\mathrm{bottom}}+\frac{{\mathrm{Plateau}}_{\mathrm{top}}-{\mathrm{Plateau}}_{\mathrm{bottom}}}{{\left(\frac{{\mathrm{EC}}_{50}}{X}\right)}^{\mathrm{HillSlope}}+1}$

Figure 3. Representative dose-response curve from [33]. The plot shows the normalized miliBRET units as a function of a non-fluorescent test compound concentration. EC₅₀ shown is the mean ± SD of three independent experiments, using the tracer MRC087 (2.0 μM). EC₅₀ was converted to K_d using the Chen-Prusoff formalism.

3. The EC₅₀ can be converted to ligand binding constants (K_dA) via Cheng–Prusoff formalism [36] using the EC₅₀ obtained for the test compound, the concentration of the tracer in the assay (L), and the tracer apparent K_d (of 913 nM, tracerDB ID T000049) [34], as shown in equation (II) below:

(I I) K d A = E C 50 1 + [ L ] K d

C. Calculate the Z’-factor of the assay

1. Using the mBRET values obtained from the 11th and 12th columns, calculate the Z’-factor to evaluate assay quality (Figure 4). Z’-factor is calculated using the means (μ) and standard deviations (σ) of the tracer (t) and blank (b) controls [37], as shown in equation (III) below:

(I II) Z ' = 1 - 3 ( σ t + σ b ) | μ t - μ b |

Note: A high-quality assay must have a Z′-factor ≥ 0.5. Lower values indicate large variability in the controls. We recommend not using data from plates with Z’-factor values below 0.5.

Figure 4. Z’-factor visualization and determination. Data obtained from the tracer and blank controls (n = 20/condition). The calculated Z’-factor for this assay was >0.5, an indication of a robust assay.

Validation of protocol

This protocol (or parts of it) has been used and validated in the following research articles:

• Cunha et al. [33]. A novel BRET-based assay to investigate binding and residence time of unmodified ligands to the human lysosomal ion channel TRPML1 in intact cells. Journal of Biological Chemistry (Figure 5).

• Cunha et al. [38]. (S)-ML-SA1 Activates Autophagy via TRPML1-TFEB Pathway. ChemBioChem (Figure 3).

General notes and troubleshooting

General notes

1. This is a competition (tracer-displacement) assay: It reports the apparent affinity (K_dA) of a ligand for TRPML1 in intact cells and therefore measures target binding together with cellular and lysosomal permeability, not channel function. Orthogonal functional assays (e.g., Ca²⁺ imaging or lysosomal patch-clamp) are recommended to distinguish agonists from antagonists and to confirm functional activity.

2. Because the assay uses full-length TRPML1 correctly localized to the lysosomal membrane, it interrogates the physiologically relevant, endolysosomal form of the channel and inherently accounts for the ability of a compound to cross both the plasma and the lysosomal membranes.

3. The approach can be adapted to other lysosomal or membrane targets, provided that a nanoluciferase fusion that expresses and localizes correctly and a cell- and lysosome-permeable fluorescent tracer that produces a target-dependent BRET signal are both available.

4. Keep the final DMSO concentration identical across all wells; a final concentration of 1% (v/v) or lower is well tolerated by HEK293T cells, whereas higher concentrations may reduce cell viability and compress the assay window.

5. Assess assay quality using the on-plate controls: derive the assay window and the Z’-factor from the tracer control (column 11) and the blank control (column 12). A Z’-factor of 0.5 or greater indicates a robust assay suitable for screening.

6. The tracer (MRC087) is light sensitive. Protect stock solutions and working mixes from light and prepare them fresh on the day of the experiment.

7. Nanoluciferase luminescence is stable from approximately 5 min to 2 h after substrate addition [39,40]. Read all plates within this window and keep the timing consistent between plates to allow direct comparison of results.

Troubleshooting

Acknowledgments

This work was supported by FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo; grant number: 2014/50897-0 and 2024/19473-0) and CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico; grant number: 465651/2014-3). M.R.C. was the recipient of a FAPESP Postdoctoral fellowship (grant number: 2021/04853-4). This protocol was described and validated in Cunha et al. [33] Journal of Biological Chemistry (2023), DOI: 10.1016/j.jbc.2023.104807.

Author contributions

Conceptualization, Investigation, Writing—Original Draft, Writing—Review & Editing, M.R.C.; Investigation, Writing—Original Draft, C.M.C.C-P; Funding acquisition, K.B.M., R.M.C.; Supervision, R.M.C.

Competing interests

The authors declare no conflicts of interest.

Ethical considerations

This protocol uses the established human cell line HEK293T (American Type Culture Collection, CRL-3216), obtained from a commercial repository. It does not involve human participants, primary human tissue, identifiable personal data, or live vertebrate animals; therefore, approval by an ethics committee and informed consent were not required. HEK293T cells were handled under biosafety level 2 (BSL-2) containment in accordance with institutional biosafety guidelines.

References

1. Schmiege, P., Fine, M., Blobel, G. and Li, X. (2017). Human TRPML1 channel structures in open and closed conformations. Nature. 550(7676): 366–370. https://doi.org/10.1038/nature24036
2. Grimm, C., Butz, E., Chen, C. C., Wahl-Schott, C. and Biel, M. (2017). From mucolipidosis type IV to Ebola: TRPML and two-pore channels at the crossroads of endo-lysosomal trafficking and disease. Cell Calcium. 67: 148–155. https://doi.org/10.1016/j.ceca.2017.04.003
3. Shen, D., Wang, X., Li, X., Zhang, X., Yao, Z., Dibble, S., Dong, X. p., Yu, T., Lieberman, A. P., Showalter, H. D., et al. (2012). Lipid storage disorders block lysosomal trafficking by inhibiting a TRP channel and lysosomal calcium release. Nat Commun. 3(1): e1038/ncomms1735. https://doi.org/10.1038/ncomms1735
4. Yu, L., Zhang, X., Yang, Y., Li, D., Tang, K., Zhao, Z., He, W., Wang, C., Sahoo, N., Converso-Baran, K., et al. (2020). Small-molecule activation of lysosomal TRP channels ameliorates Duchenne muscular dystrophy in mouse models. Sci Adv. 6(6): eaaz2736. https://doi.org/10.1126/sciadv.aaz2736
5. Capurro, M. I., Greenfield, L. K., Prashar, A., Xia, S., Abdullah, M., Wong, H., Zhong, X. Z., Bertaux-Skeirik, N., Chakrabarti, J., Siddiqui, I., et al. (2019). VacA generates a protective intracellular reservoir for Helicobacter pylori that is eliminated by activation of the lysosomal calcium channel TRPML1. Nat Microbiol. 4(8): 1411–1423. https://doi.org/10.1038/s41564-019-0441-6
6. Xia, Z., Wang, L., Li, S., Tang, W., Sun, F., Wu, Y., Miao, L. and Cao, Z. (2020). ML-SA1, a selective TRPML agonist, inhibits DENV2 and ZIKV by promoting lysosomal acidification and protease activity. Antiviral Res. 182: 104922. https://doi.org/10.1016/j.antiviral.2020.104922
7. Jung, J. and Venkatachalam, K. (2019). TRPML1 and RAS-driven cancers – exploring a link with great therapeutic potential. Channels. 13(1): 374–381. https://doi.org/10.1080/19336950.2019.1666457
8. Jung, J., Cho, K., Naji, A. K., Clemons, K. N., Wong, C. O., Villanueva, M., Gregory, S., Karagas, N. E., Tan, L., Liang, H., et al. (2019). HRAS‐driven cancer cells are vulnerable to TRPML1 inhibition. EMBO Rep. 20(4): e201846685. https://doi.org/10.15252/embr.201846685
9. Xu, M., Almasi, S., Yang, Y., Yan, C., Sterea, A. M., Rizvi Syeda, A. K., Shen, B., Richard Derek, C., Huang, P., Gujar, S., et al. (2019). The lysosomal TRPML1 channel regulates triple negative breast cancer development by promoting mTORC1 and purinergic signaling pathways. Cell Calcium. 79: 80–88. https://doi.org/10.1016/j.ceca.2019.02.010
10. Rühl, P., Rosato, A. S., Urban, N., Gerndt, S., Tang, R., Abrahamian, C., Leser, C., Sheng, J., Jha, A., Vollmer, G., et al. (2021). Estradiol analogs attenuate autophagy, cell migration and invasion by direct and selective inhibition of TRPML1, independent of estrogen receptors. Sci Rep. 11(1): 8313. https://doi.org/10.1038/s41598-021-87817-4
11. Siow, W. X., Kabiri, Y., Tang, R., Chao, Y. K., Plesch, E., Eberhagen, C., Flenkenthaler, F., Fröhlich, T., Bracher, F., Grimm, C., et al. (2022). Lysosomal TRPML1 regulates mitochondrial function in hepatocellular carcinoma cells. J Cell Sci. 135(6): e259455. https://doi.org/10.1242/jcs.259455
12. Frey, N., Ouologuem, L., Blenninger, J., Siow, W. X., Thorn-Seshold, J., Stöckl, J., Abrahamian, C., Fröhlich, T., Vollmar, A. M., Grimm, C., et al. (2024). Endolysosomal TRPML1 channel regulates cancer cell migration by altering intracellular trafficking of E-cadherin and β1-integrin. J Biol Chem. 300(1): 105581. https://doi.org/10.1016/j.jbc.2023.105581
13. Fan, C., Wu, H., Du, X., Li, C., Zeng, W., Qu, L. and Cang, C. (2024). Inhibition of lysosomal TRPML1 channel eliminates breast cancer stem cells by triggering ferroptosis. Cell Death Discovery. 10(1): 256. https://doi.org/10.1038/s41420-024-02026-y
14. Zhang, H. L., Hu, B. X., Ye, Z. P., Li, Z. L., Liu, S., Zhong, W. Q., Du, T., Yang, D., Mai, J., Li, L. C., et al. (2024). TRPML1 triggers ferroptosis defense and is a potential therapeutic target in AKT-hyperactivated cancer. Sci Transl Med. 16(753): eadk0330. https://doi.org/10.1126/scitranslmed.adk0330
15. Somogyi, A., Kirkham, E. D., Lloyd-Evans, E., Winston, J., Allen, N. D., Mackrill, J. J., Anderson, K. E., Hawkins, P. T., Gardiner, S. E., Waller-Evans, H., et al. (2023). The synthetic TRPML1 agonist ML-SA1 rescues Alzheimer-related alterations of the endosomal-autophagic-lysosomal system. J Cell Sci. 136(6): e259875. https://doi.org/10.1242/jcs.259875
16. Plesch, E., Chen, C. C., Butz, E., Scotto Rosato, A., Krogsaeter, E. K., Yinan, H., Bartel, K., Keller, M., Robaa, D., Teupser, D., et al. (2018). Selective agonist of TRPML2 reveals direct role in chemokine release from innate immune cells. eLife. 7: e39720. https://doi.org/10.7554/elife.39720
17. Grimm, C., Jörs, S., Saldanha, S. A., Obukhov, A. G., Pan, B., Oshima, K., Cuajungco, M. P., Chase, P., Hodder, P., Heller, S., et al. (2010). Small Molecule Activators of TRPML3. Chem Biol. 17(2): 135–148. https://doi.org/10.1016/j.chembiol.2009.12.016
18. Liang, C. (n.d.). Aryl-sulfonamide and aryl-sulfone derivatives as TRPML modulators (Patent No. US 2020/0352921 A1).
19. Liang, C. (n.d.). Piperazine derivatives as TRPML modulators (Patent No. WO 2018/005713 A1).
20. Leser, C., Keller, M., Gerndt, S., Urban, N., Chen, C. C., Schaefer, M., Grimm, C. and Bracher, F. (2021). Chemical and pharmacological characterization of the TRPML calcium channel blockers ML-SI1 and ML-SI3. Eur J Med Chem. 210: 112966. https://doi.org/10.1016/j.ejmech.2020.112966
21. Keeley, T. P., Siow, R. C. M., Jacob, R. and Mann, G. E. (2017). Reduced SERCA activity underlies dysregulation of Ca²⁺ homeostasis under atmospheric O₂ levels. FASEB J. 32(5): 2531–2538. https://doi.org/10.1096/fj.201700685rrr
22. Reeks, J., Mahajan, P., Clark, M., Cowan, S. R., Di Daniel, E., Earl, C. P., Fisher, S., Holvey, R. S., Jackson, S. M., Lloyd-Evans, E., et al. (2025). High throughput cryo-EM provides structural understanding for modulators of the lysosomal ion channel TRPML1. Structure. 33(8): 1374–1385.e7. https://doi.org/10.1016/j.str.2025.05.014
23. Yang, Y., Teng, S., Zhang, Y., Ji, Y. H., Wang, H. and Tan, Z. Y. (2026). Lysosomal Ion Channel TRPML1 Contributes to Neuropathic Pain Associated With Diabetic Peripheral Neuropathy in Mice. Diabetes. 75(7): 1298–1306. https://doi.org/10.2337/db25-0901
24. Ramos, P. Z., Catta-Preta, C. M. and Couñago, R. M. (2026). Target engagement in bacterial and protozoan pathogens: in vitro and cellular assays for drug discovery. Curr Opin Struct Biol. 96: 103194. https://doi.org/10.1016/j.sbi.2025.103194
25. Coriano, C., Powell, E. and Xu, W. (2016). Monitoring Ligand-Activated Protein–Protein Interactions Using Bioluminescent Resonance Energy Transfer (BRET) Assay. In H. Zhu and M. Xia (Eds.). High-Throughput Screening Assays in Toxicology (Vol. 1473, pp. 3–15). New York, NY: Springer New York. https://doi.org/10.1007/978-1-4939-6346-1_1
26. Capener, J. L., Schwalm, M. P., Vasta, J. D., Michaud, A., Teske, K. A., Marsiglia, W. M., Huber, K. V. M., Dar, A. C., Knapp, S., Axtman, A. D., et al. (2026). Advances in BRET probes for intracellular target engagement studies. Nat Chem Biol. 22(5): 691–701. https://doi.org/10.1038/s41589-025-02103-y
27. Machleidt, T., Woodroofe, C. C., Schwinn, M. K., Méndez, J., Robers, M. B., Zimmerman, K., Otto, P., Daniels, D. L., Kirkland, T. A., Wood, K. V., et al. (2015). NanoBRET—A Novel BRET Platform for the Analysis of Protein–Protein Interactions. ACS Chem Biol. 10(8): 1797–1804. https://doi.org/10.1021/acschembio.5b00143
28. Robers, M. B., Wilkinson, J. M., Vasta, J. D., Berger, L. M., Berger, B. T. and Knapp, S. (2021). Single tracer-based protocol for broad-spectrum kinase profiling in live cells with NanoBRET. STAR Protoc. 2(4): 100822. https://doi.org/10.1016/j.xpro.2021.100822
29. Gan, N., Han, Y., Zeng, W., Wang, Y., Xue, J. and Jiang, Y. (2022). Structural mechanism of allosteric activation of TRPML1 by PI(3,5)P₂ and rapamycin. Proc Natl Acad Sci USA. 119(7): e2120404119. https://doi.org/10.1073/pnas.2120404119
30. Fine, M., Schmiege, P. and Li, X. (2018). Structural basis for PtdInsP2-mediated human TRPML1 regulation. Nat Commun. 9(1): 4192. https://doi.org/10.1038/s41467-018-06493-7
31. Hall, M. P., Unch, J., Binkowski, B. F., Valley, M. P., Butler, B. L., Wood, M. G., Otto, P., Zimmerman, K., Vidugiris, G., Machleidt, T., et al. (2012). Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate. ACS Chem Biol. 7(11): 1848–1857. https://doi.org/10.1021/cb3002478
32. Walker, J. R., Hall, M. P., Zimprich, C. A., Robers, M. B., Duellman, S. J., Machleidt, T., Rodriguez, J. and Zhou, W. (2017). Highly Potent Cell-Permeable and Impermeable NanoLuc Luciferase Inhibitors. ACS Chem Biol. 12(4): 1028–1037. https://doi.org/10.1021/acschembio.6b01129
33. Cunha, M. R., Catta-Preta, C. M., Takarada, J. E., Moreira, G. A., Massirer, K. B. and Couñago, R. M. (2023). A novel BRET-based assay to investigate binding and residence time of unmodified ligands to the human lysosomal ion channel TRPML1 in intact cells. J Biol Chem. 299(6): 104807. https://doi.org/10.1016/j.jbc.2023.104807
34. Dopfer, J., Vasta, J. D., Müller, S., Knapp, S., Robers, M. B. and Schwalm, M. P. (2024). tracerDB: a crowdsourced fluorescent tracer database for target engagement analysis. Nat Commun. 15(1): 5646. https://doi.org/10.1038/s41467-024-49896-5
35. Vasta, J. D., Corona, C. R., Wilkinson, J., Zimprich, C. A., Hartnett, J. R., Ingold, M. R., Zimmerman, K., Machleidt, T., Kirkland, T. A., Huwiler, K. G., et al. (2018). Quantitative, Wide-Spectrum Kinase Profiling in Live Cells for Assessing the Effect of Cellular ATP on Target Engagement. Cell Chem Biol. 25(2): 206–214.e11. https://doi.org/10.1016/j.chembiol.2017.10.010
36. Yung-Chi, C. and Prusoff, W. H. (1973). Relationship between the inhibition constant (KI) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochem Pharmacol. 22(23): 3099–3108. https://doi.org/10.1016/0006-2952(73)90196-2
37. Zhang, J. H., Chung, T. D. and Oldenburg, K. R. (1999). A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. SLAS Discovery. 4(2): 67–73. https://doi.org/10.1177/108705719900400206
38. Cunha, M. R., Do Amaral, B. S., Takarada, J. E., Valderrama, G. V., Batista, A. N. L., Batista, J. M., Cass, Q. B., Couñago, R. M. and Massirer, K. B. (2024). (S)‐ML‐SA1 Activates Autophagy via TRPML1‐TFEB Pathway. ChemBioChem. 25(22): e202400506. https://doi.org/10.1002/cbic.202400506
39. Coutant, E. P., Gagnot, G., Hervin, V., Baatallah, R., Goyard, S., Jacob, Y., Rose, T. and Janin, Y. L. (2020). Bioluminescence Profiling of NanoKAZ/NanoLuc Luciferase Using a Chemical Library of Coelenterazine Analogues. Chemistry A European J. 26(4): 948–958. https://doi.org/10.1002/chem.201904844
40. Coutant, E. P., Goyard, S., Hervin, V., Gagnot, G., Baatallah, R., Jacob, Y., Rose, T. and Janin, Y. L. (2019). Gram-scale synthesis of luciferins derived from coelenterazine and original insights into their bioluminescence properties. Org Biomol Chem. 17(15): 3709–3713. https://doi.org/10.1039/c9ob00459a