Published: Vol 5, Iss 2, Jan 20, 2015 DOI: 10.21769/BioProtoc.1377 Views: 8755
Reviewed by: Vanesa Olivares-IllanaPia GiovannelliAnonymous reviewer(s)

Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
Related protocols

Quantification of Chromosomal Aberrations in Mammalian Cells
Inés Paniagua and Jacqueline J. L. Jacobs
Aug 20, 2023 2176 Views

Protocol for Quantifying γH2AX Foci in Irradiated Cells Using Immunofluorescence and Fiji Software
Lu Deng [...] Lingying Wu
Aug 20, 2025 1480 Views

Colocalizing Telomeres With PML or γH2AX Foci by IF-FISH in Mouse Brain Neurons
Anna Konopka
Nov 5, 2025 266 Views
Abstract
Drug-induced mitochondrial injury can be caused by many different mechanisms including inhibition of mitochondrial DNA replication, transcription, translation, and altered protein function. Determination of the level of mitochondrial DNA relative to the nuclear DNA levels provides important information on potential mitochondrial toxicity.
Keywords: Mitochondrial toxicityBackground
Materials and Reagents
Equipment
Procedure
| Primer/probe name | Oligonucleotide sequence | Concentration in qPCR |
| Cytochrome b forward | CCTTCCACCCTTACTACACAATCAA | 0.9 μM |
| Cytochrome b reverse | GGTCTGGTGAGAATAGTGTTAATGTCA | 0.9 μM |
| Cytochrome b probe | FAM-ACGCCCTCGGCTTAC-BHQ1 | 0.2 μM |
| Amount of total cellular DNA (ng/reaction) | CT Valuea | ΔCT Value | |
| Cytochome b | β-actin | ||
| 5 | 15.7 ± 0.4 | 22.2 ± 0.3 | -6.6 ± 0.1 |
| 10 | 17.3 ± 0.4 | 23.9 ± 0.3 | -6.7 ± 0.1 |
| 20 | 18.8 ± 0.3 | 25.7 ± 0.3 | -6.9 ± 0.1 |
| 40 | 20.3 ± 0.4 | 27.3 ± 0.3 | -7.0 ± 0.1 |
| Compound | Concentration (μM) | Relative amount of mtDNA (% mtDNA)a | p-value compared to DMSO (control)b |
| DMSO (control) | - | 100.0 ± 8.8 | - |
| ddC | 0.2 | 57.0 ± 10.4 | < 0.0001 |
| 2.0 | 25.1 ± 7.8 | < 0.0001 | |
| 20 | 6.9 ± 2.9 | < 0.0001 |
Recipes
Acknowledgments
All of the work was sponsored by Gilead Sciences, Inc. This protocol was adapted from Feng et al. (2014).
References
Article Information
Copyright
© 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Perron, M. and Feng, J. Y. (2015). Determination of Mitochondrial DNA Upon Drug Treatment. Bio-protocol 5(2): e1377. DOI: 10.21769/BioProtoc.1377.
Category
Molecular Biology > DNA > DNA damage and repair
Molecular Biology > DNA > DNA quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Share
Bluesky
X
Copy link
