A Simple and Easy Method for RNA Extraction from the Cyanobacterium Synechocystis sp. PCC 6803

Materials and reagents

Biological materials

1. Cyanobacterium Synechocystis sp. PCC 6803

2. PCR primers (Table 1)

Table 1. List of primers used in RT-qPCR

Reagents

1. EDTA (Sigma-Aldrich, catalog number: E9884)

2. Anhydrous citric acid (Sigma-Aldrich, catalog number: 1.93026)

3. Sodium chloride (NaCl) (Merck, catalog number: 1.06404)

4. Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: 436143)

5. Tri-sodium citrate dehydrate (Sigma-Aldrich, catalog number: 1.06448)

6. RNaseOUT (Invitrogen^TM, catalog number: 10777019)

7. DNase I (Invitrogen^TM, catalog number: 18080044)

8. Superscript III (Invitrogen^TM, catalog number: 18068015)

9. qPCRBIO SyGreen Blue Mix Separate Rox (PCRBIOSYSTEMS, catalog number: PB20.17)

10. Liquid nitrogen

11. Diethyl pyrocarbonate (DEPC)-treated MilliQ water (Thermo Fisher Scientific, catalog number: AM9922)

12. Agarose (Sigma-Aldrich, catalog number: A2576)

13. Tris-borate-EDTA (TBE), 10× buffer (Thermo Scientific Chemicals, catalog number: J62788.K2)

14. Deoxyribonucleotide triphosphate (dNTP) mix (Thermo Scientific, catalog number: FERR0192)

15. 96-well plates (Bio-Rad, catalog number: HSP9601)

16. Dithiothreitol (DTT) (Thermo Scientific Chemicals, catalog number: AC327190010)

17. Phusion DNA polymerase (NEB, catalog number: M0530)

18. 1 kb Plus DNA ladder (Thermo Fisher Scientific, catalog number: 10787018)

19. RNA loading dye (NEB, catalog number: B0363S)

20. DNA loading dye (NEB, catalog number: B7024S)

21. BG-11 media (Gibco, catalog number: A1379901)

22. Isopropanol (Thermo Scientific Chemicals, catalog number: 327272500)

Solutions

1. Lysis buffer (see recipes)

2. Precipitation buffer (see recipes)

Recipes

1. Lysis buffer

2. Precipitation buffer

Note: Lysis and precipitation buffer can be stored at room temperature up to one year. Filtration/autoclaving is not needed.

Laboratory supplies

1. Nuclease-free microfuge tubes (Eppendorf, catalog number: 022364111)

2. Nuclease-free pipette tips (Eppendorf, catalog number: 0030078748)

Equipment

1. Pipettes (GILSON, catalog numbers: F167500, F167300)

2. Vortex (USA Scientific Inc, catalog number: 74045600)

3. Refrigerated tabletop micro centrifuge (Eppendorf centrifuge 5415 R, with rotor, catalog number: 022621431)

4. Mini centrifuge (Thermo Scientific^TM, catalog number: 75004061)

5. Thermocycler (Eppendorf Mastercycler^® nexus X2, catalog number: 6337000043)

6. TissueLyser II (QIAGEN, catalog number: 85300)

8. Agarose gel electrophoresis system (Analytik Jena, model: Biometra Horizon 58)

9. LightCycler^® 480 system (Roche, catalog number: 05 015 278 001)

10. Gel Doc XR+ System (Bio-Rad, catalog number: 170–8195)

11. NanoDrop (Thermo Fisher Scientific, catalog number: ND-ONE-W)

12. Steel beads (5 mm) (QIAGEN, catalog number: 69989)

13. UV-Visible spectrophotometer (JASCO, model: V-550)

Procedure

A. Sample collection

1. Grow 150 mL of liquid culture of cyanobacteria in BG-11 medium until it reaches an OD₇₃₀ of 0.8–1.0.

2. Harvest the cells by spinning them in a Beckman centrifuge at 5,000× g for 10 min at room temperature.

3. Discard the supernatant and resuspend the pellet in 5 mL of BG-11 medium.

4. Transfer 1 mL of sample into a 1.7 mL microfuge tube.

B. RNA extraction

B1. Method 1

1. Vigorously vortex the sample for 5 min at maximum speed.

2. Add 300–400 μL of lysis buffer to the cell suspension and gently mix by pipetting up and down 5 times using a 1,000 μL pipette.

3. Add 150 μL of precipitation buffer to the cell lysate and mix by inversion (10 times).

4. Incubate cell lysate on ice for 5–7 min.

5. After incubation, centrifuge the sample at 15,000× g for 3 min on a small benchtop centrifuge to pellet the unbroken cells and membranes.

6. Transfer the supernatant to a new microfuge tube without disturbing the pellet, then centrifuge at 16,000× g for 4 min to remove any remnants.

7. After centrifugation, transfer the supernatant to another clean microfuge tube and mix with 100% isopropanol in a 1:1 ratio.

8. Incubate the sample for 7 min on ice, followed by 10 min at room temperature.

9. Following incubation, centrifuge the sample mixture at 15,000× g for 5 min using a small benchtop centrifuge.

10. Discard supernatant and wash the pellet with 400 μL of cold 70% ethanol. Centrifuge again at 15,000× g for 5 min.

11. Remove the ethanol carefully without disturbing the RNA pellet.

12. Air dry the pellets by inverting the tubes on a clean paper towel with the lid open for 10–15 min.

13. Gently resuspend the dried pellet in 40 μL of DEPC-treated Milli-Q water and centrifuge at 16,000× g for 5 min to remove impurities and remnants. Impurities and remnants go to the pellet.

14. Transfer the RNA-containing supernatant to a clean microfuge tube and store it at -80 °C for later analysis.

B2. Method 2

1. Snap-freeze resuspended cells in liquid nitrogen and break them using one stainless steel bead per tube in a TissueLyser II (bead bashing for 1 min at 30 rps). Transfer the cell lysates to a new microfuge tube and proceed with step B1.2 and subsequent steps from method 1. See Figure 1 for the graphical presentation of RNA extraction methods.

Figure 1. Overview of RNA extraction method

C. Quantification and purity check

Note: Data corresponding to this section are presented in Table 2.

1. Assess the purity and quantity of extracted RNA samples with a NanoDrop. Take 1 μL of isolated RNA and measure its concentration and purity.

2. The absorbance values at 260 and 280 nm (A260/280) indicate the purity and concentration of the isolated RNA.

3. The A260/280 and A260/230 ratios should be in the range of 1.9–2.1 and 2.0–2.2, respectively. The purity check results for the extracted RNA samples show the A260/280 and A260/230 ratios in the above range, indicating that the extracted RNA is of good quality and devoid of contaminants.

Table 2. Concentration and purity of RNA samples

D. Integrity check

Note: Data corresponding to this section are presented in Figure 2.

1. Use agarose gel electrophoresis to determine the integrity of RNA.

2. Load 1 μL of extracted RNA, 2 μL of loading dye, and a molecular marker onto a 1% agarose gel. Run for 50 min at 150 V using TBE (1×) buffer.

3. Use a Gel Doc XR+ System to capture and analyze the gel image. A good RNA sample should display obvious, distinct bands on the gel that correspond to 23S, 16S, and 5S RNA. If the RNA sample shows bands or smears below the 5S RNA band, this indicates that the RNA has been degraded or contaminated.

Figure 2. Electrophoretic mobility of extracted RNA on a 1% agarose gel. (A) Total RNA extracted from samples using Method 1 (section B1). (B) Total RNA extracted from samples using Method 2 (section B2). Samples 1–7 represent independent biological repeats. A 1 kb Plus DNA ladder was used in each gel.

E. DNase I treatment

Note: Data corresponding to this section are presented in Figure 3.

1. In a thermocycler, incubate 1 μg of extracted RNA with 1 μL of DNase I for 30 min at 37 °C.

2. To assess genomic DNA degradation, run 1 μL of DNase I-treated RNA on a 1% agarose gel alongside 1 μL of the untreated sample.

3. To further verify DNA degradation, run a PCR using samples with and without DNase I treatment as template. Add the following to each tube: 1.25 μL of forward and reverse primers (10 μM), 0.5 μL of dNTP mix (10 mM), 5 μL of 5× GC buffer, 0.75 μL of MgCl₂ (50 mM), 0.25 μL of Phusion DNA polymerase, 1 μL of template, and H₂O up to 25 μL. PCR conditions are as follows:

a. Initial denaturation: 98 °C for 30 s

b. Denaturation (35 cycles): 98 °C for 10 s

c. Annealing: (according to the primers) for 30 s

d. Extension: 72 °C for 30 s/kb

e. Final extension: 72 °C for 10 min

4. Run 1 μL of PCR product from DNase I–treated sample on a 1% agarose gel alongside 1 μL of PCR product from DNase I–untreated sample. The treated sample should not provide any PCR products on the gel, whereas an amplified product from the untreated sample is expected.

Figure 3. Gel electrophoresis of DNase I–treated RNA sample and the amplified PCR products. (A) Gel represents the electrophoretic mobility of DNase I–treated and untreated RNA samples in lanes 3 and 2, respectively. (B) Amplified PCR products from DNase I–untreated samples are presented in lanes 2 and 4; treated sample is in lane 6. The psbDII gene was amplified using fwd: AGTGTGTTTAGCGGCCCAAG, and rev: GTGGTGCAAACAGCGCAACA primers. Lane 1 represents the molecular marker (1 kb plus DNA ladder).

F. Complementary DNA (cDNA) synthesis

Note: Data corresponding to this section are presented in Figure 4.

1. Transfer approximately 500 ng of DNase I–treated RNA to a clean, RNase-free microfuge tube, leaving the remaining 500 ng of RNA in the original tube. Keep the tubes on ice. Label one tube as “RT” and the other as “NO RT”.

2. Add the following to each tube: 0.65 μL of random primers (250 ng/μL) (6:2:1:1 mix of 7, 8, 9, and 10-mers), 1 μL of dNTP mix (40 mM), 4 μL of 5× first-strand synthesis buffer, 2 μL of 0.1 M DTT (ensure all DTT is resuspended before use), and 0.75 μL of RNaseOUT.

3. Mix them by inversion followed by a quick spin.

4. Incubate the mixture at 25 °C for 5 min prior to the addition of Superscript III reverse transcriptase.

5. Add 1 μL of Superscript III to the “RT” tube and 1 μL of water to the “NO RT” tube. Mix them with gentle pipetting and inversion only, followed by a quick spin.

6. Incubate in a thermocycler for 60 min at 50 °C (55 °C if using a gene-specific primer).

7. After incubation, heat-inactivate the sample for 15 min at 70 °C.

8. Keep the cDNA at -20 °C for later use.

9. Check the cDNA synthesis on a 1% agarose gel. The cDNA sample should show multiple bands on the agarose gel, confirming the presence of cDNA.

Figure 4. Electrophoretic mobility of RT-PCR products (cDNA) on 1% agarose gel. Lane 1 represents 1 Kb plus DNA ladder. Lane 3 represents PCR product without Superscript III reverse transcriptase. Lane 5 represents PCR products with Superscript III reverse transcriptase.

G. Quantitative reverse transcription polymerase chain reaction (RT-qPCR)

Note: Data corresponding to this section are presented in Figures 5 and 6 and Table 3.

1. Dilute cDNA 1:4 in DEPC-treated MilliQ water.

2. Transfer 4 μL of diluted cDNA to a 96-well plate. Add 1 μL of gene-specific 10 μM primer mix (forward and reverse primers) and 5 μL of 2× qPCRBIO SyGreen Blue Mix to the well containing cDNA.

3. PCR conditions:

a. Pre-incubation: 95 °C for 5 min

b. Amplification (45 cycles): 95 °C for 10 s

58 °C for 10 s

72 °C for 08 s

c. Melting curve: 95 °C for 5 s

65 °C for 1 min

97 °C [acquisition mode: continuous; acquisition (per °C): 5]

d. Cooling: 40 °C for 30 s

4. RT-qPCR results for the non-template control and no-reverse transcriptase control should not show any amplification curves, whereas the sample containing template and enzyme should exhibit one amplification curve and one melting peak for a particular gene of interest. Expect an RT-qPCR efficiency of 90%–100% for high-quality RNA and cDNA samples.

Figure 5. qPCR analysis results. (A) Melting peaks. (B) Amplification curves. Data are shown for psbA2 (dark blue), psbA3 (purple), psbB (yellow green) psbC (orange), psbDI (red), psbDII (magenta), psbE (yellow), psbF (maroon), psbJ (cyan), psaA (light blue), psaB (pink), and rnpB (green).


Figure 6. qPCR analysis results of non-template control and no-reverse transcriptase control. The non-template samples are blue, green, olive, cyan, brown, light blue, maroon, gray, purple, lime, and salmon. The no-reverse transcriptase samples are red, pink, yellow, magenta, orange, light green, violet, indigo, navy blue, mustard, and pale green.

Table 3. qPCR analysis results

Data analysis

Raw data collected from Nanodrop and RT-qPCR are presented in tables. Gel images were created using Microsoft Publisher imaging software. The RT-qPCR data of the targeted genes can be calculated (relative expression or fold change) using the 2^-ΔΔCT or comparative C_T method [35–36].

Validation of protocol

This protocol has been used and validated in the following research article:

1. Majhi and Eaton-Rye [1]. PsbE:Phe10 of cytochrome b559 modifies inactivation and recovery of Photosystem II in response to high-light stress. Physiologia Plantarum (Figure S16 and S17).

In this study, this protocol was used to measure the expression of various photosynthetic genes. Cyanobacterial cells were treated with different light conditions, and the extracted RNA samples were used to assess the expression of genes for photosystem proteins in response to varied light conditions. At least three biological replicates were performed to verify the robustness of this protocol. The results presented in [1] demonstrate the effectiveness of this protocol.

General notes and troubleshooting

General notes

1. RNA is very sensitive to temperature. As such, keep the RNA sample on ice to prevent degradation.

2. Breaking cells using the TissueLyser improves yield by 15–20 times compared to vortexing the cells. Extracted RNA using both methods had a small quantity of remnant genomic DNA.

3. DNase treatment is necessary for downstream applications.

4. The whole extraction process generally takes less than 1 h.

Troubleshooting

Problem 1: Low yield.

Possible cause: Cells were not broken completely.

Solution: Vortex or bead-beat a little longer.

Problem 2: Low or high A260/280 nm values.

Possible causes: Impurities or protein contamination.

Solution: Centrifuge the dissolved RNA pellet again and carefully take out the supernatant without disturbing the pellet.

Acknowledgments

Conceptualization, B.K.M.; Investigation, B.K.M.; Writing—Original Draft, B.K.M.; Writing—Review & Editing, B.K.M., J.E.-R.; Funding acquisition, J.E.-R.; Supervision, J.E.-R.

Funding sources: University of Otago Ph.D. scholarship. University of Otago, Biochemistry Department internal funds. Original research paper in which this protocol was described: [1].

Competing interests

The authors declare no conflicts of interest.

References

1. Majhi, B. K. and Eaton‐Rye, J. J. (2025). PsbE:Phe10 of Cytochrome b ₅₅₉ Modifies Inactivation and Recovery of Photosystem II in Response to High‐Light Stress. Physiol Plant. 177(5): e70585. https://doi.org/10.1111/ppl.70585
2. Majhi, B. K. (2025). Carbon capture, storage, and utilization in cyanobacteria. Carbon Resour Convers. 100388. https://doi.org/10.1016/j.crcon.2025.100388
3. Majhi, B. K. (2025). Cyanobacteria: Photosynthetic cell factories for biofuel production. J Bioresour Bioprod. 10(2): 128–144. https://doi.org/10.1016/j.jobab.2024.10.001
4. Majhi, B. K. and Melis, A. (2024). Recombinant protein synthesis and isolation of human interferon alpha-2 in cyanobacteria. Bioresour Technol. 400: 130664. https://doi.org/10.1016/j.biortech.2024.130664
5. Muñoz-Marín, M. d. C., López-Lozano, A., Moreno-Cabezuelo, J. Ã., Díez, J. and García-Fernández, J. M. (2024). Mixotrophy in cyanobacteria. Curr Opin Microbiol. 78: 102432. https://doi.org/10.1016/j.mib.2024.102432
6. Barten, R. and Lill, H. (1995). DNA-uptake in the naturally competent cyanobacterium,Synechocystis sp.PCC 6803. FEMS Microbiol Lett. 129(1): 83–87. https://doi.org/10.1111/j.1574-6968.1995.tb07561.x
7. Kufryk, G. I., Sachet, M., Schmetterer, G. and Vermaas, W. F. (2002). Transformation of the cyanobacterium Synechocystissp. PCC 6803 as a tool for genetic mapping: optimization of efficiency. FEMS Microbiol Lett. 206(2): 215–219. https://doi.org/10.1111/j.1574-6968.2002.tb11012.x
8. Majhi, B. K. (2025). Cyanobacteria: A Biological Chassis for Industrial Applications. Cyanobacteria - Exploring Their Role in Energy, Environment and Industry [Working Title]. e1012978. https://doi.org/10.5772/intechopen.1012978
9. Ikeuchi, M. and Tabata, S. (2001). Synechocystis sp. PCC 6803 — a useful tool in the study of the genetics of cyanobacteria. Photosynth Res. 70(1): 73–83. https://doi.org/10.1023/a:1013887908680
10. Corchete, L. A., Rojas, E. A., Alonso-López, D., De Las Rivas, J., Gutiérrez, N. C. and Burguillo, F. J. (2020). Systematic comparison and assessment of RNA-seq procedures for gene expression quantitative analysis. Sci Rep. 10(1): e1038/s41598–020–76881–x. https://doi.org/10.1038/s41598-020-76881-x
11. Stanton, L. (2001). Methods to Profile Gene Expression. Trends Cardiovasc Med. 11(2): 49–54. https://doi.org/10.1016/s1050-1738(01)00085-8
12. Singh, K. P., Miaskowski, C., Dhruva, A. A., Flowers, E. and Kober, K. M. (2018). Mechanisms and Measurement of Changes in Gene Expression. Biol Res Nurs. 20(4): 369–382. https://doi.org/10.1177/1099800418772161
13. Zhang, M., Liu, Y. H., Chang, C. S., Zhi, H., Wang, S., Xu, W., Smith, C. W. and Zhang, H. B. (2019). Quantification of gene expression while taking into account RNA alternative splicing. Genomics. 111(6): 1517–1528. https://doi.org/10.1016/j.ygeno.2018.10.009
14. Mohr, K. I., Brinkmann, N. and Friedl, T. (2011). Cyanobacteria. Reitner, J. and Thiel, V. (Eds.) Encyclopedia of Geobiology. Springer Netherlands, 306–311. https://doi.org/10.1007/978-1-4020-9212-1_221
15. Pinto, F. L., Thapper, A., Sontheim, W. and Lindblad, P. (2009). Analysis of current and alternative phenol based RNA extraction methodologies for cyanobacteria. BMC Mol Biol. 10(1): e1186/1471–2199–10–79. https://doi.org/10.1186/1471-2199-10-79
16. Kim, B., Oh, H., Lee, Y., Choi, G., Ahn, C., Yoon, B. and Kim, H. (2006). SIMPLE METHOD FOR RNA PREPARATION FROM CYANOBACTERIA¹. J Phycol. 42(5): 1137–1141. https://doi.org/10.1111/j.1529-8817.2006.00263.x
17. Singh, S. P., Sinha, R. P., Daiker, V. and Häder, D. P. (2009). Quantitative and qualitative extraction of RNA from a filamentous cyanobacterium Anabaena variabilis PCC 7937. J Appl Phycol. 22(1): 113–116. https://doi.org/10.1007/s10811-009-9428-7
18. Kim Tiam, S., Comte, K., Dalle, C., Duval, C., Pancrace, C., Gugger, M., Marie, B., Yéprémian, C. and Bernard, C. (2019). Development of a new extraction method based on high-intensity ultra-sonication to study RNA regulation of the filamentous cyanobacteria Planktothrix. PLoS One. 14(9): e0222029. https://doi.org/10.1371/journal.pone.0222029
19. Cárdenas Espinosa, M. J., Schmidgall, T., Wagner, G., Kappelmeyer, U., Schreiber, S., Heipieper, H. J. and Eberlein, C. (2021). An optimized method for RNA extraction from the polyurethane oligomer degrading strain Pseudomonas capeferrum TDA1 growing on aromatic substrates such as phenol and 2,4-diaminotoluene. PLoS One. 16(11): e0260002. https://doi.org/10.1371/journal.pone.0260002
20. Babich, H. and Davis, D. (1981). Phenol: A review of environmental and health risks. Regul Toxicol Pharm. 1(1): 90–109. https://doi.org/10.1016/0273-2300(81)90071-4
21. Joshi, D. R. and Adhikari, N. (2019). An Overview on Common Organic Solvents and Their Toxicity. J Pharm Res Int. : 1–18. https://doi.org/10.9734/jpri/2019/v28i330203
22. Rahman, M. M., Rahaman, M. S., Islam, M. R., Rahman, F., Mithi, F. M., Alqahtani, T., Almikhlafi, M. A., Alghamdi, S. Q., Alruwaili, A. S., Hossain, M. S., et al. (2021). Role of Phenolic Compounds in Human Disease: Current Knowledge and Future Prospects. Molecules. 27(1): 233. https://doi.org/10.3390/molecules27010233
23. Dos Reis Falcão, V., Pedroso Tonon, A., Cabral Oliveira, M. and Colepicolo, P. (2007). RNA Isolation method for polysaccharide rich algae: agar producing Gracilaria tenuistipitata (Rhodophyta). J Appl Phycol. 20(1): 9–12. https://doi.org/10.1007/s10811-007-9174-7
24. Wang, X., Tian, W. and Li, Y. (2007). Development of an Efficient Protocol of RNA Isolation from Recalcitrant Tree Tissues. Mol Biotechnol. 38(1): 57–64. https://doi.org/10.1007/s12033-007-0073-6
25. Sim, M. C., Ho, C. L. and Phang, S. M. (2013). A simple and effective method for RNA isolation and cDNA library construction from the brown seaweed Sargassum polycystum (Fucales, Phaeophyceae). J Appl Phycol. 25(5): 1277–1285. https://doi.org/10.1007/s10811-013-9980-z
26. Greco, M., Sáez, C. A., Brown, M. T. and Bitonti, M. B. (2014). A Simple and Effective Method for High Quality Co-Extraction of Genomic DNA and Total RNA from Low Biomass Ectocarpus siliculosus, the Model Brown Alga. PLoS One. 9(5): e96470. https://doi.org/10.1371/journal.pone.0096470
27. Jensen, T., Saleh, L., Bents, D., Krohn, S., Wu, Y. C., Mucke, M., Boje, A. S., Veltel, S., Hennig, S., Piker, L., et al. (2023). Optimised protocols for RNA extraction from a broad taxonomic range of algae. J Appl Phycol. 35(4): 1743–1753. https://doi.org/10.1007/s10811-023-02980-7
28. Pathak, R. R. and Lochab, S. (2010). A method for rapid isolation of total RNA of high purity and yield from Arthrospira platensis. Can J Microbiol. 56(7): 578–584. https://doi.org/10.1139/w10-045
29. Yu, L., Wu, X., Yu, Y., Shi, L. and Zhang, M. (2019). Recruitment of cyanobacteria by reverse transcription quantitative real-time PCR based on expression of Microcystis gene. PeerJ. 7: e7188. https://doi.org/10.7717/peerj.7188
30. Rump, L. V., Asamoah, B. and Gonzalez-Escalona, N. (2010). Comparison of commercial RNA extraction kits for preparation of DNA-free total RNA from Salmonella cells. BMC Res Notes. 3(1): e1186/1756–0500–3–211. https://doi.org/10.1186/1756-0500-3-211
31. Joseph, L. J. (2016). Setting Up a Laboratory. Genetic Diagnosis of Endocrine Disorders. 409–426. https://doi.org/10.1016/b978-0-12-800892-8.00029-4
32. Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S., Menzel, W., Granzow, M., Ragg, T., et al. (2006). The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol. 7(1): e1186/1471–2199–7–3. https://doi.org/10.1186/1471-2199-7-3
33. Ma, H., Bell, K. N. and Loker, R. N. (2021). qPCR and qRT-PCR analysis: Regulatory points to consider when conducting biodistribution and vector shedding studies. Mol Ther Methods clin dev. 20: 152–168. https://doi.org/10.1016/j.omtm.2020.11.007
34. Harshitha, R. and Arunraj, D. R. (2021). Real‐time quantitative PCR: A tool for absolute and relative quantification. Biochem Mol Biol Educ. 49(5): 800–812. https://doi.org/10.1002/bmb.21552
35. Livak, K. J. and Schmittgen, T. D. (2001). Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 25(4): 402–408. https://doi.org/10.1006/meth.2001.1262
36. Schmittgen, T. D. and Livak, K. J. (2008). Analyzing real-time PCR data by the comparative CT method. Nat Protoc. 3(6): 1101–1108. https://doi.org/10.1038/nprot.2008.73