Materials and reagents

Gene-specific Alt-R^® CRISPR-Cas9 sgRNA [Integrated DNA Technologies (IDT)], store at -80 °C
ssODN: gene-specific Alt-R^® HDR Donor Oligos (IDT)
eSpCas9-GFP protein (Sigma-Aldrich, catalog number: ECAS9GFPPR-50UG), store at -20 °C
Note: Using a GFP-tagged Cas9 helps visualize electroporation efficiency, but is not needed
Alt-R^® HDR enhancer 100 μL (IDT, catalog number: 1081072), store at -20 °C
Neon^TM Transfection System 10 μL kit, containing buffers R, T, and E, as well as Neon^TM tips and Neon^TM electroporation tubes (Thermo Fisher Scientific, catalog number: MPK1025), store buffers at 4 °C after opening; store the remaining components at room temperature (RT)
Sodium chloride (NaCl) (Sigma-Aldrich, catalog number: S3014)
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541)
Sodium phosphate dibasic (Na₂HPO₄) (Sigma-Aldrich, catalog number: S9763)
Potassium phosphate monobasic (KH₂PO₄) (Sigma-Aldrich, catalog number: P5655)
Growth medium suitable for the cell type used [here, we used RPMI 1640 (Sigma Aldrich, catalog number: R8758) supplemented with 10% fetal bovine serum]
Nano-Glo^® HiBiT lytic detection system (Promega, catalog number: N3030), store at -20 °C
cOmplete^TM proteinase inhibitor cocktail (Roche, catalog number: 11697498001), store at -20 °C
Nano-Glo^® HiBiT blotting system (Promega, catalog number: N2410), store at -20 °C
White microplates suitable for luminescence
4%–20% Mini-PROTEAN^® TGC Stain-Free^TM protein gel (Bio-Rad, catalog number: 4568093)
Molecular weight marker, such as Precision Plus Protein^TM Kaleidoscope^TM Standard (Bio-Rad, catalog number: 1610375EDU)
Trans-Blot Turbo RTA Mini 0.2 μm Nitrocellulose Transfer kit (Bio-Rad, catalog number: 1704270)
Tris-HCl (Sigma-Aldrich, catalog number: 1083190100)
Triton^® X-100 (Sigma-Aldrich, catalog number: X100)
Sodium deoxycholate (Sigma-Aldrich, catalog number: D6750)
Tris base (Trizma® base, Sigma-Aldrich, catalog number: 93352)
Tween^® 20 (Sigma-Aldrich, catalog number: P1379)
PBS (see Recipes)
Lysis buffer for HiBiT blotting (see Recipes)
TBS-T (see Recipes)

Equipment

Neon^TM transfection system (Thermo Fisher Scientific, catalog number: MPK5000)
Luminescence plate reader (Tecan Group, Tecan Infinite^® 200 PRO)
2-D protein electrophoresis equipment (Mini-PROTEAN Tetra Vertical Electrophoresis Cell and PowerPac Power supply, Bio-Rad)
Trans-Blot Turbo transfer system
ChemiDoc XRS+ imaging system (Bio-Rad)

Software

gRNA design tools:
https://chopchop.cbu.uib.no/, https://eu.idtdna.com/site/order/designtool/index/CRISPR_SEQUENCE
http://crispor.tefor.net/
ImageLab: acquisition of chemiluminescent images using ChemiDoc imaging system
ImageJ: relative quantification of chemiluminescent signal

Procedure

Design of gRNA and ssODN

Identify desired locus of HiBiT tag insertion (for example at the C- or N-terminal end, directly after the start codon or right before the stop codon).
Identify appropriate gRNA sequences within ± 30 nucleotides of locus of insertion; for improved result, compare gRNA efficiency over various publicly available algorithms (we have not tested gRNA sequences more than 30 nt away from the site of insertion).
Design ssODN with at least 80 nucleotides homology arms upstream and downstream of Cas9 cut site (total length of ssODN is 180–200 nt).

To prevent Cas9 from binding to and cutting the ssODN, insert 2–3 silent mutations into the gRNA sequence within the ssODN, preferentially the PAM sequence if possible.

Table 1. Sequences for homology-directed repair–mediated insertion of HiBiT-tag into C-terminus of Hexokinase isoforms

Protein	sgRNA sequence	PAM	ssODN
HK2	ATAGAACCCCTGAAATCGGA	AGG	CTGCAGTCAGAGGATGGCAGCGGGAAGGGGGCGGCGCTCATCACTGCTGTGGCCTGCCGCATCCGTGAGGCTGGACAGCGAGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCTAGATCCCCTGAAATCGAAAGCGACTTCCTCTTTCTCTCCTTCTTCCCTGTTTTAAATTATAAGATGTCATCCCCTTGTGT
HK3	TCGTGTCTGAGGAAACCTCC	CGG	GATGGGTCCGGCAAAGGTGCGGCCCTGGTCACCGCTGTTGCCTGCCGCCTTGCGCAGTTGACTCGTGTCGTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGCTGAGGAAACCTCCACGCTGAGGAGGTCTCCGCCGCAGCCTTGCTGGAGCCGGGTCGGGGTCTGCCTGTTTCCCAGCCAGGCCC

blue: HiBiT tag; orange: sgRNA sequence; red: Stop codon; green: PAM sequence; purple: silent mutations inserted to prevent Cas9 from binding to ssODN

Electroporation
1. Prepare stock solutions:
  1. Cas9: 20 μM
  2. sgRNA: 50 μM
  3. ssODN: 100 μM
2. In a total volume of 7 μL, add 15 pmol of Cas9 and 75 pmol of sgRNA to buffer R or T (depending on the cell type, see Neon^TM instructions).
  Note: The ratio between sgRNA and Cas9 can be empirically titrated for best efficiency. We recommend a ratio of 5:1–9:1.
  Example, per reaction:
  1.5 μL of sgRNA (75 pmol)
  0.75 μL of Cas9 (15 pmol)
  4.75 μL of buffer R or T
3. Incubate for 15 min at RT. RNP complexes are stable for 1 h at RT.
  Note: RNPs can be complexed prior to the experiment and stored for two weeks at 4 °C or up to at least 10 weeks at -80 °C without loss in performance.
4. Prepare a 96-well plate with 100 μL of growth medium (suitable for your cell type) containing 30 μM of HDR enhancer to collect cells after electroporation. Prewarm to 37 °C.
5. Add 75 pmol of ssODN (0.75 μL of 100 μM stock) to the complexed RNPs.
6. Wash in PBS.
7. Prepare the electroporator station: fill electroporation tube with 3 mL of buffer E. Settings vary depending on the cell line, and optimized settings and cell numbers for many cell lines can be found at Thermo Fisher (https://www.thermofisher.com/us/en/home/life-science/cell-culture/transfection/neon-transfection-system/neon-transfection-system-cell-line-data.html).
8. Count cells, take the appropriate cell number, and resuspend in 5 μL of buffer R or T per electroporation, including appropriate controls (electroporation only, untargeted sgRNA).
9. Add 5 μL of cell suspension to 7 μL of RNP complex. Keep cell exposure to buffers R or T at a minimum (≤ 15 min).
10. Using a 10 μL Neon^TM electroporation tip, electroporate cells and transfer into prewarmed media (step B4).
11. Transfer cells to a humidified incubator at 37 °C with 5% CO₂ immediately.
12. Do not disturb cells for 24 h.
13. After 24 h, electroporation efficiency can be assessed visually by examining the presence of eCas9-GFP in live cells using a fluorescent microscope. Handle plate with care and avoid extended exposure to ambient temperature.
Check for HiBiT insertion
1. Let cells grow until you can comfortably remove 5 × 10⁴ cells.
2. Prepare Nano-Glo^® HiBiT lytic detection reagent by allowing buffer to thaw to RT.
  Note: This assay can be performed in various well formats. We prefer using the 384-well format and adding 20 μL of detection reagent to 20 μL of cell suspension. For statistical reasons, we recommend performing the assay in no less than triplicates.
3. Dilute assay reagents into assay buffer according to the manufacturer’s instructions.
4. Count cells and add equal numbers of cells per well.
  Note: We use 15,000 cells per 384-well plate.
5. Add detection reagent and ensure homogeneous lysis by pipetting up and down. Be sure to include a no-HiBiT-expressing negative control.
6. Equilibrate to RT for 10 min.
7. Measure luminescence.
Monoclonal population
In case editing efficiency or endogenous protein expression is very low, single-cell monoclonal populations can be obtained through limiting dilution assay.
1. To improve efficiency in growing edited monoclonal populations, we recommend preselecting HiBiT-expressing populations grown from 10 cells and performing limiting dilution assay after preselection.
  1. Of edited bulk population, plate 10 cells/well in a 96-well format.
  2. After enough cells have grown, screen populations for highest HiBiT expression using Nano-Glo^® HiBiT lytic detection.
  3. From the highest expressing populations, perform limiting dilution assay.
  4. Grow and screen monoclonal populations.
HiBiT blotting (optional)
To ensure the HiBiT insertion has occurred at the correct protein, the size of the fusion protein can be tested via blotting.
1. Isolate protein using the lysis buffer for HiBiT blotting (see Recipes) and quantify protein content (e.g., Bradford assay).
2. Separate the appropriate volume of protein for the expected protein expression on a gel (e.g., 4%–20% Mini-PROTEAN^® TGC Stain-Free^TM protein gel) and include a molecular weight marker.
3. If using stain-free gel technology, activate gel according to the manufacturer’s protocol.
4. Transfer protein onto a nitrocellulose membrane (e.g., via semi-dry Turbo-Blot transfer).
5. After transfer, wash membrane in TBS-T (see Recipes). Do not allow membrane to dry.
6. Acquire total protein image to allow for relative quantification.
7. Prepare Nano-Glo^® HiBiT blotting solution according to the manufacturer’s instructions: dilute LgBiT protein 200-fold with 1× Nano-Glo^® blotting buffer, mix by inversion, remove TBS-T, and cover the membrane in blotting solution.
8. Incubate for 1 h at RT while gently rocking.
  Note: For increased signal, incubation can be prolonged up to overnight incubation at 4 °C. If incubating at 4 °C, allow equilibration to RT before adding the substrate after incubation.
9. Dilute the Nano-Glo^® Luciferase Assay Substrate 500-fold into the solution covering the membrane.
10. Incubate for 5 min at RT.
11. Acquire chemiluminescent image using an appropriate imager (e.g., ChemiDoc XRS+).
  Note: As an alternative to the HiBiT blotting system, a conventional immunoblot can be performed using Promega’s mouse anti-HiBiT mAB (catalog number: N7200).
Perform your experiment
1. Quantify relative endogenous protein expression at desired time points using NanoGlo^® HiBiT lytic detection (Figure 2), Nano-Glo^® HiBiT blotting system (Figure 3), or conventional immunoblot.
  
  Figure 2. Relative quantification of hexokinase 2 (HK2) and HK3 protein levels upon all-trans retinoic acid (ATRA, 1 μM) treatment of HiBiT-tagged HL60 AML cell lines. Endogenous tagging allows to specifically detect upregulation of isoform 3, while levels of isoform 2 remain constant.
  
  Figure 3. Nano-Glo^® HiBiT blotting system. Steady-state hexokinase 2 (HK2) and HK3 levels in HL60 AML cells detected via HiBiT tag. Of note, HK3 is very lowly expressed at steady-state level in AML cells.

Data analysis

Nano-Glo^® HiBiT lytic detection: quantify relative protein expression using luminescence readings, subtracting readings of negative control.

Nano-Glo^® HiBiT blotting system: quantify relative protein expression via luminescence signal on images, using software like ImageJ. Normalize to the volume of total protein or to a housekeeping reference protein (β-tubulin, GAPDH).

Notes

To verify insertion of HiBiT tag, it is also possible to perform a PCR reaction using a primer pair that is specific for both the tag as well as the locus of insertion.
Insertion locus of the tag: the optimal tag-insertion locus for each protein of interest should be determined individually. Tag insertion at either the C- or N-terminal end of HK2 and HK3 resulted in the generation of a luminescent signal. We do not currently know if insertion of the tag at genomic regions other than the termini allows for binding of the LgBiT adaptor protein.
Splice variants: this protocol is applicable for highly homologous proteins encoded on different chromosomes as well as splicing variants that differ in either their first or last exon. For other splice isoforms, it would need to be tested whether integration of the HiBiT tag internally allows for binding of the LgBiT adaptor protein while preserving protein function.

Recipes

PBS
137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8mM KH₂PO₄
Lysis buffer for HiBiT blotting
50 mM Tris-HCl, 150 mM NaCl, 1% Triton^® X-100, 0.1% sodium deoxycholate, pH 7.5
TBS-T
20 mM Tris base, 150 mM NaCl, 0.1% Tween^® 20

Acknowledgments

We thank Promega for technical support during optimization of this protocol. This study was supported by grants from the Swiss National Science Foundation and Krebsforschung Schweiz (31003A_173219 to MPT and MD-PhD 03/17 Scholarship to KS).

Competing interests

The authors declare no conflict of interests.

References

Dixon, A. S., Schwinn, M. K., Hall, M. P., Zimmerman, K., Otto, P., Lubben, T. H., Butler, B. L., Binkowski, B. F., Machleidt, T., Kirkland, T. A., et al. (2016). NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells. ACS Chem Biol 11(2): 400-408.
Schwinn, M. K., Machleidt, T., Zimmerman, K., Eggers, C. T., Dixon, A. S., Hurst, R., Hall, M. P., Encell, L. P., Binkowski, B. F. and Wood, K. V. (2018). CRISPR-Mediated Tagging of Endogenous Proteins with a Luminescent Peptide. ACS Chem Biol 13(2): 467-474.
Schwinn, M. K., Steffen, L. S., Zimmerman, K., Wood, K. V. and Machleidt, T. (2020). A Simple and Scalable Strategy for Analysis of Endogenous Protein Dynamics. Sci Rep 10(1): 8953.
Voskuil, J. L. A. (2017). The challenges with the validation of research antibodies. F1000Res 6: 161.