Detection of Individual RNA in Fixed Cells and Tissues by Chromogenic ISH

Materials and Reagents

1. Secure-Seal hybridization chamber, 9 mm diameter, 0.8 mm deep (Containing seal tabs, Thermo Scientific, catalog number: S24732)
2. EasYFlask 25 cm² (Thermo Scientific Nunc, catalog number: 156340-ROS)
3. Serological Pipette (Thermo Scientific Nunc, 2 ml, 5 ml, 10 ml, 50 ml)
4. Cell culture Dish, 150 mm x 20 mm (Thermo Scientific Nunc, catalog number: 168381-ROS)
5. Adhesion Microscope Slides (Citotest, catalog number: 188105)
6. 15 ml Conical Centrifuge Tubes (Thermo Scientific Nunc, catalog number: 339650-SPL)
7. 50 ml Conical Centrifuge Tubes (Thermo Scientific Nunc, catalog number: 339652-SPL)
8. Filtered Pipette Tip (QSP, 0.1-10 µl, 2-20 µl, 10-100 µl, 20-200 µl, 100-1,000 µl)
9. 0.2 ml PCR Tubes (AXYGEN, catalog number: PCR-02-C)
10. 1.5 ml Microtubes (AXYGEN, catalog number: MCT-150-C)
11. 0.22 μm membrane filter (Millipore, catalog number: SLGP033RS)
12. HER2 padlock probe (sequence: 5′-ATTACTTGCAGGTTCTTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTTCAGAATTCGTCCCCGG, underline: target hybridization sequences andd detection probe complementary part, bold italics: RCA primer binding part) (Synbio Tech, China)
13. ACTB padlock probe (sequence: 5′-CTGTGCTCGCGGGGCGTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTTGGCAAAGGCGAGGCT, underline: target hybridization sequences and detection probe complementary part, bold italics: RCA primer binding part) (Synbio Tech, China)
14. RCA primer (sequence: 5′-ACAGCAGCAGCATTGAGGTC) (Synbio Tech, China)
15. HRP labeled detection probe (sequence: 5′ HRP-CCTCAATGCTGCTGCTGTACTAC) (TaKaRa)
16. Pepsin (Sigma-Aldrich, catalog number: P7012-1G), store at -20 °C
17. Fetal Bovine Serum (Hyclone, catalog number: 10270-106), store at -20 °C
18. Trypsin (Hyclone, catalog number: SH30042.01), store at -20 °C
19. ATP, 100 mM Solution (Thermo Scientific, catalog number: R0441), store at -20 °C
20. T4 Polynucleotide Kinase, 10 U/µl (Thermo Scientific, catalog number: EK0032, containing PNK buffer A), store at -20 °C
21. dNTP Set, 100 mM Solutions (Thermo Scientific, catalog number: R0182), store at -20 °C
22. SplintR Ligase, 25 U/µl (NEB, catalog number: M0375L), store at -20 °C
23. phi29 DNA Polymerase, 10 U/µl (Thermo Scientific, catalog number: EP0094), store at -20 °C
24. BSA, 20 mg/ml (NEB, catalog number: B9000S), store at -20 °C
25. RiboLock RNase Inhibitor, 40 U/µl (Thermo Scientific, catalog number: EO0384), store at -20 °C
26. Tween-20 (Sigma-Aldrich, catalog number: P9416-100ML), store at room temperature (RT)
27. Triton X-100 (Sigma-Aldrich, catalog number: T8787-100ML), store at RT
28. NaOH (Sigma-Aldrich, catalog number: 795429-500G), store at RT
29. KCl (Sigma-Aldrich, catalog number: P9541-500G), store at RT
30. NaCl (Sigma-Aldrich, catalog number: S3014-1kG), store at RT
31. Na₂HPO₄ (BBI LIFE SCIENCES, catalog number: A610404-0500), store at RT
32. KH₂PO₄ (Sangon Biotech, catalog number: A100781-0500), store at RT
33. Sodium iodate (BBI LIFE SCIENCES, catalog number: A600859), store at RT
34. Aluminum potassium sulfate dodecahydrate (Sangon Biotech, catalog number: A500755), store at RT
35. Glycerol (Sigma-Aldrich, catalog number: G9012-100ML), store at RT
36. Hematoxylin (Sigma-Aldrich, catalog number: H3136-25G), store at RT
37. Neutral balsam mounting medium (BBI LIFE SCIENCES, catalog number: E675007), store at RT
38. Xylene (XILONG SCIENTIFIC, catalog number: 33535-500ML), store at RT
39. Ethanol (Macklin, catalog number: E809061-500 ML), store at RT
40. Acetate (Macklin, catalog number: A801295-500 ML), store at RT
41. Hydrochloric acid (SCR, catalog number: 10011018), store at RT
42. DEPC (Sigma-Aldrich, catalog number: D5758-25ML), store at 4 °C
43. Paraformaldehyde (Sigma-Aldrich, catalog number: 16005-1KG-R), store at 4 °C
44. Formamide (Sigma-Aldrich, catalog number: F9037-100ML), store at 4 °C
45. 20x SSC buffer (Sigma-Aldrich, catalog number: S6639), store at 4 °C
46. 1x Phosphate Buffered Saline (Hyclone, catalog number: SH30256.01), store at 4 °C
47. DNase/RNase-Free Water (Solarbio, catalog number: R1600), store at 4 °C
48. Hydrogen peroxide solution, 30 wt.% in H₂O (Macklin, catalog number: H811240-500 ml), store at 4 °C
49. DAB Immunohistochemistry Color Development Kit (BBI LIFE SCIENCES, catalog number: EP670033), store at -20 °C
50. EDTA (Sigma-Aldrich, catalog number: RDD017-500G), store at RT
51. Serum-free medium, DMEM/HIGH GLUCOSE (Hyclone, catalog number: SH30022.01), store at 4 °C
52. Penicillin-Streptomycin (Hyclone, catalog number: SV30010), store at -20 °C
53. Culture media (50 ml) (see Recipes)
54. 10x PBS (500 ml), pH 6.8 (see Recipes)
55. 1x DEPC-PBS (1 L), pH 7.4 (see Recipes)
56. 1x DEPC-PBST (1 L) (see Recipes)
57. 4% (w/v) PFA (500 ml) (see Recipes)
58. 1x TE buffer (100 ml), pH 8.0 (see Recipes)
59. 0.5%(v/v) Triton X-100 (5 ml) (see Recipes)
60. 3% (w/v) H₂O₂ solution (50 μl) (see Recipes)
61. 2x hybridization buffer (5 ml) (see Recipes)
62. Washing buffer (15 ml) (see Recipes)
63. 2x detection buffer (5 ml) (see Recipes)
64. Staining buffer (50 μl) (see Recipes)
65. 0.1% hydrochloric acid-ethanol (5 ml) (see Recipes)
66. Hematoxylin Staining Solution (50 ml) (see Recipes)
67. 25 mM dNTPs (100 μl) (see Recipes)
    

Equipment

1. Vortex Mixers (MIULAB, model: MIX-25P)
2. Microcentrifuge (MIULAB, model: Mini-6K)
3. Magnetic stirrer (IKA, RCT basic)
4. pH meter (OHAUS, model: starter3100)
5. PCR machine (BIOER, model: TC-XP)
6. Analytical balance (OHAUS, model: AS220.R2)
7. Pipette (Eppendorf AG, Research plus)
8. Cell culture incubator (Esco, model: CCL-170B-8)
9. Biosafety cabinet (Esco, model: AC2-4S1)
10. Ultra-low temperature freezer (Thermo, model: DW-86L338)
11. Freezer (Siemens, model: KG32EV2S0C)
12. Electro-heating standing-temperature cultivator (ENXIN, model: DRP-9052)
13. Microscope (Leica, model: DM6B, equipped with a DFC7000T camera)
    

Software

1. CellProfiler
2. GraphPad Prism
   

Procedure

1. Cell culture and sample preparation
   1. Pre-warm 2 ml 1x DEPC-PBS, 23 ml culture media and 0.8 ml 0.25% (w/v) trypsin-EDTA to 37 °C.
   2. Remove the used culture media in the cell culture flask (take 25 cm² flask for example).
   3. Wash briefly with 2 ml 1x DEPC-PBS. Aspirate PBS.
   4. Add 0.8 ml 0.25% (w/v) trypsin-EDTA into flask and cover the cells.
   5. Check the cells with inverted microscope to be sure that most of the cells are rounded up, but still attached to the flask. Carefully remove trypsin.
   6. Add 3 ml culture media to the flask, suspend the cells from attached cell layer and mix them well by pipetting.
   7. Put 5 slides into a Petri dish and add 20 ml culture media into it to cover the slides.
   8. Seed the resuspended cells on slides.
   9. Rest for at least 10 min until resuspended cells subside on the slides.
   10. Transfer the Petri dish into the cell culture incubator (37 °C, 5% CO₂).
   11. Culture the cells until they reach 80% confluence (12-48 h).
   12. After 12-48 h incubation, remove and discard the culture media.
   13. Wash 3 times with 25 ml 1x DEPC-PBS for 3 min each.
   14. Add 25 ml 4% (w/v) PFA into the Petri dish to cover the slides for 30 min at RT.
   15. Wash twice with 25 ml 1x DEPC-PBS for 3 min each.
   16. Perform dehydration using an ethanol series of 70%, 85%, and ethanol absolute for 5 min each. Air dry.
   Note: The sample slides can be stored at -80 °C until used.
   
   
2. Pretreatments
   1. Phosphorylate padlock probes before use. Prepare 50 μl mix containing 38 μl DEPC-H₂O, 1 μl padlock probes (100 μM), 5 μl PNK buffer A (10x), 5 μl ATP (10 mM), 1 μl T4 polynucleotide kinase (10 U/μl) in the 0.2 ml PCR Tubes.
   2. Incubate the above mixture at 37 °C for 30 min and 65 °C for 10 min in the PCR machine.
   Note: For formalin-fixed, paraffin-embedded pathological tissue sections, perform pretreatments procedures 3 to 20, expect 17 and 18. For cell samples, perform pretreatments procedures 14 to 20.
   3. Bake the slide at 60 °C for 30 min.
   4. Put the slide into the xylene for 15 min and another fresh xylene for 10 min, respectively.
   5. Put the slide into ethanol absolute twice, 95% ethanol twice, and 70% ethanol twice for 2 min each time.
   6. Treat the slide with DEPC-H₂O for 5 min to complete rehydration.
   7. Wash with DEPC-PBS for 2 min.
   8. Perform the fixation procedure with 4% (w/v) PFA in DEPC-PBS for 10 min.
   9. Wash with DEPC-PBS for 2 min.
   10. Put the slide into the solution of 0.1 mg/ml pepsin in 0.1 M HCl for 30 min at 37 °C.
   11. Wash with DEPC-H₂O for 5 min.
   12. Wash with DEPC-PBS for 2 min.
   13. Dehydrate the slide by an an ethanol series of 70%, 85%, and ethanol absolute for 1 min each.
   14. Air dry.
   15. Assemble the 9 mm diameter and 0.8 mm depth Secure-Seal hybridization chamber to the surface of the slide on the side where the samples are (Figure 1). All the following incubation step take place in the chamber with a volume of 50 μl.
       
       
       Figure 1. Assemble hybridization chamber to the surface of slide where the samples are. Place a seal-tab over each filling port to prevent evaporation of the solutions and the drying out of the specimen.
       
       
   16. Rinse the cell sample with DEPC-PBS with 0.05% Tween-20 (DEPC-PBST).
   17. Add 50 μl 0.5%(v/v) Triton X-100 (in DEPC-PBS) into the chamber to permeabilize the cells for 10 min at RT.
   18. Wash 3 times with 1x DEPC-PBST.
   19. Apply 50 μl 3% (w/v) H₂O₂ solution to the sample for 15 min at RT to block endogenous peroxidases.
   20. Wash 3 times with DEPC-PBST.
       
       
       
3. Padlock probe hybridization
   1. Prepare 50 μl padlock probe hybridization mix containing 22.5 μl DEPC-H₂O, 25 μl 2x hybridization buffer and 2.5 μl phosphorylated padlock probe (2 μM, from B2).
   2. Add the mix into the chamber and incubate for 2 h at 37 °C.
   3. Wash 3 times with washing buffer for 5 min each.
   4. Wash 3 times with DEPC-PBST.
      
      
      
4. Padlock probe ligation
   1. Prepare 50 μl padlock probe ligation mix containing 6.5 μl DEPC-H₂O, 31.25 μl 80% (v/v) glycerol, 5 μl BSA (2 mg/ml), 1.25 μl RiboLock RNase Inhibitor (40 U/μl), 5 μl SplintR ligase reaction buffer (10x) and 1 μl SplintR ligase (25 U/μl).
   2. Add the mix into the chamber and incubate for 1 h at 37 °C.
   3. Wash 3 times with washing buffer for 5 min each.
      
      
      
5. RCA primer hybridization
   1. Prepare 50 μl RCA primer hybridization mix containing 20 μl DEPC-H₂O, 25 μl 2x hybridization buffer and 5 μl RCA primer (10 μM).
   2. Add the mix into the chamber and incubate for 30 min at 37 °C
   3. Wash 3 times with washing buffer for 5 min each.
   4. Wash 3 times with DEPC-PBST.
      
      
      
6. RCA
   1. Prepare 50 μl RCA mix containing 26.75 μl DEPC-H₂O, 5 μl 50% (v/v) glycerol, 2 μl dNTP (25 mM), 5 μl BSA (2 mg/ml), 1.25 μl RiboLock RNase Inhibitor (40 U/μl), 5 μl phi29 DNA polymerase buffer (10x) and 5 μl phi29 polymerase (10 U/μl).
   2. Add the mix into the chamber and incubate for 16-18 h at RT.
   3. Wash 3 times with washing buffer for 5 min each.
      
   4. Wash 3 times with DEPC-PBST.
      
      
      
7. RCA products detection
   1. Prepare 50 μl RCA products detection mix containing 10 μl DEPC-H₂O, 25 μl 2x detection buffer, 12.5 μl 80% (v/v) glycerol and 2.5 μl HRP-labeled detection probe (2 μM).
   2. Add the mix into the chamber and incubate for 30 min at RT.
   3. Wash 3 times with DEPC-PBST.
   
   
8. Staining and mounting
   1. Incubate the sample with staining solution for 3 to 8 min depending on the color development.
   2. Wash 3 times with DEPC-H₂O.
   3. Stain the nuclei in Hematoxylin staining solution for 1 min.
   4. Wash 3 times with DEPC-H₂O.
   5. Differentiate with 0.1% hydrochloric acid-ethanol for 1 min.
   6. Wash 3 times with DEPC-H₂O.
   7. Place slide in 1x DEPC-PBS for 1 min.
   8. Wash 3 times with DEPC-H₂O.
   9. Remove the chamber and rinse in running tap water for 5 min.
   10. Dehydrate the slide by an ethanol series of 70%, 85%, and ethanol absolute for 1 min each.
   11. Mount the slide with 15-20 μl neutral balsam mounting medium.
       
       
       
9. Image acquisition
   1. Acquire images with bright-filed microscope using the 40x objective.
   2. In images, brown dots are detected individual mRNA molecules and nuclei are shown in blue (Figures 2 and 3).
      
      
      Figure 2. Detection of ACTB mRNA molecules in MCF-7 cells. Scale bar = 40 μm.
      
      
      Figure 3. Detection of HER2 mRNA molecules in HER2-positive and HER2-negative breast cancer FFPE tissue sections. Scale bars = 40 μm.

Data analysis

Quantitative analysis of detected RNA molecules is achieved by using CellProfiler image analysis software. The images are processed with “Unmixcolors”, “EnhanceOrSuppressFeatures”, “IndentifyPrimaryObjects”, “IndentifySecondaryObjects”, “IndentifyPrimaryObjects” and “RelateObjects” modules in turn. To remove the background, the “Unmixcolors” module is used to split into hematoxylin and DAB two channels. The “EnhanceOrSuppressFeatures” module is used to highlight DAB staining spots. Finally, the relation of signals with their host cells is identified with the “RelateObjects” module. Then the number of RCPs per cell was listed. Statistical plotting was performed using GraphPad Prism.

Notes

1. For FFPE tissue sections and fresh frozen tissue sections, the pretreatment is different due to different kinds of tissue, including permeabilization and fixation.
2. Oligonucleotides were dissolved and diluted with 1x TE buffer. The stock concentration of the padlock probe, RCA primer and detection probe were 100 μM, 10 μM and 2 μM respectively.
3. According to the cell type, adjust the experimental conditions of nucleic counterstaining, such as staining time, concentration of stain fluid.
4. DEPC is heat inactivated before using the solution.
5. Aspirate the solutions from the previous steps before adding a new solution into the chamber.
   
   
   

Troubleshooting: A list of possible reasons for experiment failures and solutions are listed in Table 1.

Table 1. Troubleshooting table

Recipes

1. Culture media (50 ml)
   45 ml serum-free medium
   5 ml fetal bovine serum
   0.5 ml Penicillin-Streptomycin Solution
   Store at 4 °C
2. 10x PBS (500 ml), pH 6.8
   40 g NaCl
   1 g KCl
   7.2 g Na₂HPO₄
   1.2 g KH₂PO₄
   500 ml ultrapure water
   Filter the solution using 0.22 μm membrane filter
   Prepare fresh
3. 1x DEPC-PBS (1 L), pH 7.4
   100 ml 10x PBS
   900 ml ultrapure water
   1 ml DEPC
   Store at 4 °C
4. 1x DEPC-PBST (1 L)
   1 L DEPC-PBS
   0.5 ml Tween-20
   Store at 4 °C
5. 4% (w/v) PFA (500 ml)
   For a 4% paraformaldehyde solution:
   1. Add 20 g of EM grade paraformaldehyde to 480 ml of 1x DEPC-PBS
   2. Add 5 ml of 5 M NaOH and stir gently on a heating block at ~30 °C until the paraformaldehyde is dissolved
   3. Allow the mixture to cool to room temperature and adjust the pH to 7.4 with HCl
   4. Then adjust the final volume to 500 ml with 1x DEPC-PBS
   5. Filter the solution through a 0.22 μm membrane filter to remove any particulate matter
   6. Make the paraformaldehyde solution fresh prior to use, or store in aliquots at -20 °C for several months. Avoid repeated freeze/thawing
6. 1x TE buffer (100 ml), pH 8.0
   1 ml 1 M Tris-HCl (pH 8.0)
   0.2 ml 0.5 M EDTA (pH 8.0)
   98.8 ml DEPC-H₂O
   Filter the solution using 0.22 μm membrane filter
   Store at 4 °C
7. 0.5%(v/v) Triton X-100 (5 ml)
   25 μl Triton X-100
   4.975 ml DEPC-H₂O
   Store at RT
8. 3% (w/v) H₂O₂ solution (50 μl)
   5 μl 30% (w/v) H₂O₂
   45 μl DEPC-H₂O
   Prepare fresh
9. 2x hybridization buffer (5 ml)
   3 ml 20x SSC
   1 ml Formamide
   1 ml DEPC-H₂O
   Store at RT
10. Washing buffer (15 ml)
    1.5 ml 20x SSC
    3 ml Formamide
    10.5 ml DEPC-H₂O
    Store at RT
11. 2x detection buffer (5 ml)
    1 ml 20x SSC
    5 μl Tween-20
    0.2 ml 20 mg/ml BSA
    3.975 ml DEPC-H₂O
    Store at 4 °C
12. Staining buffer (50 μl)
    45 μl DAB buffer
    2.5 μl 20x DAB substrate solution
    2.5 μl 20x DAB chromogen solution
    Prepare fresh
13. 0.1% hydrochloric acid-ethanol (5 ml)
    50 μl hydrochloric acid
    3.713 ml ethanol
    1.237 ml DEPC-H₂O
    Store at RT
14. Hematoxylin Staining Solution (50 ml)
    1. Dissolve 0.1 g hematoxylin with 12.5 ml ethanol
    2. Dissolve 0.85 g aluminum potassium sulfate dodecahydrate with 37.5 ml DEPC-H₂O
    3. Then mix the two solutions
    4. After hematoxylin is oxidized to a purplish red by adding 10 mg sodium iodate, add 0.5 ml acetate
    5. Filter the solution using 0.22 μm membrane filter. Store at RT
    6. Concentration of hematoxylin staining solution can be diluted with DEPC-H₂O
15. 25 mM dNTP (100 μl)
    25 μl 100 mM ATP
    25 μl 100 mM GTP
    25 μl 100 mM CTP
    25 μl 100 mM TTP
    Store at -20 °C
    

Competing interests

Authors declare no conflicts of interest or competing interests.

Acknowledgments

This work was supported by the funds from the National Natural Science Foundation of China (31770927), the National Key Research and Development Program of China (2017YFA0106800), the Natural Science Foundation of Fujian Province, and the Scientific Research Funds of Huaqiao University.

References

1. Banér, J., Nilsson, M., Mendel-Hartvig, M. and Landegren, U. (1998). Signal amplification of padlock probes by rolling circle replication. Nucleic Acids Res 26(22): 5073-5078.
2. Battich, N., Stoeger, T. and Pelkmans, L. (2013). Image-based transcriptomics in thousands of single human cells at single-molecule resolution. Nat Methods 10(11): 1127-1133.
3. Crosetto, N., Bienko, M. and van Oudenaarden, A. (2015). Spatially resolved transcriptomics and beyond. Nat Rev Genet 16(1): 57-66.
4. Femino, A. M., Fay, F. S., Fogarty, K. and Singer, R. H. (1998). Visualization of single RNA transcripts in situ. Science 280(5363): 585-590.
5. Jiang, M., Liu, L., Hong, C., Chen, D., Yao, X., Chen, X., Lin, C. and Ke, R. (2019). Single molecule chromogenic in situ hybridization assay for RNA visualization in fixed cells and tissues. RNA 25(8): 1038-1046.
6. Larsson, C., Grundberg, I., Soderberg, O. and Nilsson, M. (2010). In situ detection and genotyping of individual mRNA molecules. Nat Methods 7(5): 395-397.
7. Nilsson, M., Malmgren, H., Samiotaki, M., Kwiatkowski, M., Chowdhary, B. P. and Landegren, U. (1994). Padlock probes: circularizing oligonucleotides for localized DNA detection. Science 265(5181): 2085-2088.
8. Shah, S., Lubeck, E., Schwarzkopf, M., He, T. F., Greenbaum, A., Sohn, C. H., Lignell, A., Choi, H. M., Gradinaru, V., Pierce, N. A. and Cai, L. (2016). Single-molecule RNA detection at depth by hybridization chain reaction and tissue hydrogel embedding and clearing. Development 143(15): 2862-2867.
9. Wang, F., Flanagan, J., Su, N., Wang, L. C., Bui, S., Nielson, A., Wu, X., Vo, H. T., Ma, X. J. and Luo, Y. (2012). RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues. J Mol Diagn 14(1): 22-29.