Published: Vol 9, Iss 16, Aug 20, 2019 DOI: 10.21769/BioProtoc.3334 Views: 7171
Reviewed by: Arnau Busquets-GarciaValeria B Fernandez ValloneAnonymous reviewer(s)

Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
Related protocols

Efficient Gene-Editing in Human Pluripotent Stem Cells Through Simplified Assembly of Adeno-Associated Viral (AAV) Donor Templates
Berta Marcó de La Cruz [...] Fredrik H. Sterky
Nov 5, 2024 3302 Views

Temporally and Spatially Controlled Age-Related Prostate Cancer Model in Mice
Sen Liu [...] Qiuyang Zhang
Jan 5, 2025 3085 Views

Histomorphometrical Analyses of the Mouse Suprachiasmatic Nucleus
Sophia A.M.B. Villanueva [...] Cristina A. Ghiani
Jun 5, 2026 364 Views
Abstract
Recently developed gene editing technologies based on engineered CRISPR/Cas9 systems enables researchers to disrupt genes in a cell type-specific manner in the adult mouse brain. Using these technologies, we recently showed that the dopamine beta-hydroxylase gene in Locus Coeruleus (LC) norepinephrine neurons plays a vital role in the maintenance of wakefulness. Our method consists of four steps, (1) crossing Cre-dependent spCas9 knockin mice with a Cre-driver mouse line to express spCas9 in the target neural populations, (2) cloning of sgRNA, (3) construction of an AAV (adeno associated virus) vector expressing dual sgRNA, and (4) virus packaging and stereotaxic injection of the virus into the target brain area. Here, we describe a detailed protocol of AAV vector construction for cell type-specific CRISPR gene editing in the adult mouse brain. The method adopts a dual-sgRNA strategy for efficient disruption of the target gene. At first, a few different sgRNAs targeting the same gene are cloned into a plasmid expressing spCas9. After evaluation of the sgRNAs by a T7 endonuclease assay, the two most efficient sgRNAs are cloned in tandem into an AAV vector using the Gibson Assembly method.
Keywords: CRISPR/Cas9Background
Interrogation of gene functions in specific cell subtypes in the brain remains a challenge. The conventional techniques such as RNAi-based methods lack cellular specificity and efficiency. On the other hand, recently developed gene editing techniques using the CRISPR/Cas9 system allows researchers efficient gene disruption in a cell type-specific manner. A research group led by Feng Zhang showed the disruption of multiple genes in the adult mouse brain by AAV-mediated delivery of sgRNA (Swiech et al., 2015). Also, the group established cre-dependent spCas9 knockin mice (Platt et al., 2014). In a recent study, we used an AAV vector carrying dual sgRNA to improve the efficiency of bi-allelic gene targeting (Yamaguchi et al., 2018). We here describe a protocol for the construction of dual sgRNA AAV vector (Figure 1).
Figure 1. Schematic representation of all the procedure. Our method consists of four steps: (1) crossing Cre-dependent spCas9 knockin mice with a Cre-driver mouse line to express spCas9 in the target neural populations, (2) cloning of sgRNA into the spCas9 expressing plasmid, (3) construction of an AAV vector tandemly expressing dual sgRNA, and (4) AAV packaging and stereotaxic viral injection into the target brain area.
Materials and Reagents
Optional (see Procedure C)
Equipment
Procedure
| X μl | pX458 (10 μg) |
| 5 μl | 10x NEB cut smart |
| 1 μl | BbsI-HF |
| 24 - X μl | MilliQ water |
| 30 μl | in total |
| 1 μl | oligonucleotide, sense (100 μM) |
| 1 μl | oligonucleotide, antisense (100 μM) |
| 8 μl | 1x Tris-EDTA buffer |
| 10 μl | in total |
| 1 μl | diluted (1:100 with 1x Tris-EDTA buffer) annealed oligonucleotides |
| 1 μl | BbsI-digested pX458 (50 ng/μl) |
| 5 μl | 2x ligation buffer |
| 1 μl | Quick ligase |
| 2 μl | MilliQ water |
| 10 μl | in total |
| 6 μl | lysate |
| 1.5 μl | dNTP (the mixture of dTTP, dCTP, dGTP and dATP, each at a final concentration of 10 mM) |
| 12 μl | 5x buffer |
| 1.5 μl | primer S (10 μM) |
| 1.5 μl | primer AS (10 μM) |
| 1 μl | PrimeSTAR HS DNA polymerase |
| 36.5 μl | MilliQ water |
| 60 μl | in total |


| X μl | pAAV EF1α DIO mCherry (10 μg) |
| 5 μl | 10x NEB cut smart |
| 1 μl | MluI-HF |
| 24 - X μl | MilliQ water |
| 30 μl | in total |
| 3 μl | pX458-sgRNA#1 (10 ng/μl) |
| 1.5 μl | dNTP, 10 mM each |
| 12 μl | 5x buffer |
| 1.5 μl | primer S1 (10 μM); 5’- taggggttcctgcggccgcacgcgtgagggcctatttc -3’ |
| 1.5 μl | primer AS1 (10 μM); 5’- ataggccctctctagaaaaaaagcaccgactc -3’ |
| 1 μl | PrimeSTAR HS DNA polymerase |
| 39.5 μl | MilliQ water |
| 60 μl | in total |
| 3 μl | pX458-sgRNA#2 (10 ng/μl) |
| 1.5 μl | dNTP, 10 mM |
| 12 μl | 5x buffer |
| 1.5 μl | primer S2 (10 μM); 5’- tttttctagagagggcctatttcccatg -3’ |
| 1.5 μl | primer AS2 (10 μM); 5’- atccatctttgcaaagcttacgcgtaaaaaagcaccgac -3’ |
| 1 μl | PrimeSTAR HS DNA polymerase |
| 39.5 μl | MilliQ water |
| 60 μl | in total |
| 45 μl | PCR amplicon#1 or #2 |
| 5 μl | 10x NEB cut smart |
| 1 μl | DpnI |
| 51 μl | in total |
| 1 μl | CIP-treated MluI-digested pAAV EF1α DIO mCherry (100 ng/μl) |
| 3 μl | PCR amplicon#1 |
| 3 μl | PCR amplicon#2 |
| 3 μl | MilliQ water |
| 10 μl | Gibson Assembly mix |
| 20 μl | in total |
Recipes
All materials and reagents are commercially available.
Acknowledgments
H.Y. was supported by Uehara memorial foundation research fellowship. L.d.L was supported by National Institute of Health Grants AG047671, MH087592, MH102638. This protocol was adapted from Yamaguchi et al. (2018) and includes a recent improvement of the method of our lab.
Competing interests
Competing interestsThe authors declare no competing financial interests.
References
Article Information
Copyright
© 2019 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Yamaguchi, H. and de Lecea, L. (2019). Construction of Viral Vectors for Cell Type-specific CRISPR Gene Editing in the Adult Mouse Brain. Bio-protocol 9(16): e3334. DOI: 10.21769/BioProtoc.3334.
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Molecular Biology > DNA > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link
