Materials and Reagents

Note: All reagents were purchased from Thermo Fisher if not indicated otherwise and were stored at room temperature.

Pipette tips
Plastic foil
Syringe
Gel spacers 0.8 mm (Cole-Parmer, UX-28573-12)
Hybridization tubes 2 x 200 mm (VWR, catalog number: 32645-030)
Whatman paper (Whatman^TM, 10427812 Grade)
Hybond-XL membrane (GE Healthcare, catalog number: 45-001-148)
5’ ³²P-labeled oligonucleotide probes (see Procedure B)
[γ-³²P] ATP (PerkinElmer, catalog number: NEG035C005MC) (storage: -20 °C)
T4 Polynucleotide kinase (10 U/µl) (Thermo Fisher, catalog number: EK0032) (storage: -20 °C)
1x T4 PNK buffer
3-Acrylamidophenylboronic acid (Frontier Scientific, catalog number: A10094-5g) (storage: 4 °C)
40% acrylamide/bis solution, 29:1 (Bio-Rad, catalog number: 161-0146)
Acetic acid
DMEM (Thermo Fisher, catalog number: 11965092)
EDTA
Ethanol, 95.5% USP (Ricca, catalog number: R2916000-1A)
Fetal Bovine Serum dialyzed (Thermo Fisher, catalog number: 26400044)
Queuine Hydrochloride (Toronto Research Chemicals, catalog number: Q525000)
Sodium acetate
Sodium chloride (NaCl)
Sodium dodecyl sulfate (SDS)
Sodium phosphate monobasic (NaH₂PO₄) (Thermo Fisher, catalog number: BP329)
Sodium phosphate dibasic (Na₂HPO₄) (Thermo Fisher, catalog number: S374)
10x TAE buffer (Sigma-Aldrich, catalog number: 11666690001)
Tris (Bioland Scientific, catalog number: CT01-5kg)
Urea
Bromophenol blue
Xylene cyanol
10x TBE buffer (EMD Millipore, catalog number: 8850-OP)
Sodium acetate (KOAc)
Sodium chloride (KCl)
Nuclease-free water
2x Gel loading buffer (see Recipes)
10% denaturing polyacrylamide gel (see Recipes)
10% APB polyacrylamide gel (see Recipes)
Dialyzed serum medium (see Recipes)
Gel extraction buffer (see Recipes)
Hybridization buffer (see Recipes)
1 M Sodium phosphate buffer (pH 7.0) (see Recipes)
1 M Tris-HCl buffer (pH 9.0) (see Recipes)
Washing solution (see Recipes)

Equipment

Pipettes
Microcentrifuge (Eppendorf, model: 5415D)
Hybridization Oven (UVP, model: 95-0030-01)
Phosphoimager (Bio-Rad, Molecular Imager Pharosfx Plus System, 170-9460)
Phosphor screens (Bio-Rad or Fuji)
X-ray Cassette K 35 x 43 cm (Bio-Rad)
Polyacrylamide gel electrophoresis apparatus with glass plates 17 x 15 cm (Biometra, Model V16-2)
Thermoblock 24 x 1.5 ml (Eppendorf, 022670522)
Tube rotator (Cole-Parmer Ltd, model: SB3)
Vacuum gel dryer (Bio-Rad, Model 583 Gel Dryers)
Incubator
4 °C refrigerator
-20 °C freezer

Software

Quantity One (Bio-Rad Laboratories, Inc., www.bio-rad.com/)

Procedure

Human cell culture
1. Obtaining Q-deprived (0Q) human cells
  Culture your cells in dialyzed serum medium for at least five doublings. The Q-modification level is expected to decrease by a factor of 2 after each doubling.
2. Generating fully Q-modified (100Q) human cells
  Add queuine hydrochloride solution to the cell culture media at a final concentration of 0.1-1 µM and incubate for at least 12 h.
  Note: Conditions provided here were verified for HEK293T cells, these need to be optimized separately for each cell line used.
3. RNA extraction (described below)
³²P-labeling and purification of Northern probes
Before proceeding to the Northern blot analysis, prepare 5’ ³²P-labeled oligonucleotide probes that are complementary to tRNA species of interest. If needed, prepare probes for a tRNA not modified with Q (e.g., tRNA^Ala) as a negative control.
Warning: [γ-³²P] ATP is highly radioactive. Follow all safety procedures required in handling radioactive material (e.g., ordering, storage, personal protection, shielding, preventing and detecting contamination etc.). Contact the appropriate lab/department safety inspector for more information, also about available trainings.
Oligonucleotide probe sequences for human tRNAs are:
(tRNA^His)5’TGCCGTGACTCGGATTCGAACCGAGGTTGCTGCGGCCACAACGCAGAGTACTAACCACTATACGATCACGGC;
(tRNA^Asn)5’CGTCCCTGGGTGGGCTCGAACCACCAACCTTTCGGTTAACAGCCGAACGCGCTAACCGATTGCGCCACAGAGAC;
Oligonucleotides can be ordered from DNA synthesizing company (e.g., IDT, gel purified is good enough).
1. Labeling the oligos with [γ-³²P] ATP by T4 PNK reaction
  1. Use 20 pmol of each oligo for labeling.
  2. Set up the reaction with 1x T4 PNK buffer from the supplier, 6 U/µl T4 PNK, 28 µCi/µl [γ-³²P] ATP and add water to the final volume of 10 µl.
  3. Incubate for 30 min at 37 °C in a thermoblock.
  4. Inactivate T4 PNK by adding 2x gel loading buffer.
2. Gel purification of the probes
  1. Load the samples on 10% denaturing polyacrylamide gel.
  2. Run the gel at 18 W until the first dye BPB is at the bottom of the gel (typically about 1 h).
  3. Expose the gel to a phosphorimager screen for 1 min (this time can vary depending on the radioactivity of the probes).
  4. Based on the signal, excise the bands corresponding to the probe.
  5. Incubate crushed gel slices with gel extraction buffer and rotate the mixture at 4 °C overnight on a tube rotator.
3. Precipitation of the probes
  1. Centrifuge the samples at maximum speed for 30 min and collect the solution from the gel slices above.
  2. Precipitate the DNA using 3 volumes of 100% ethanol at -20 °C for 2 h.
  3. Centrifuge the samples at maximum speed for 30 min and remove the supernatant.
  4. Wash the pellet with 70% ethanol.
  5. Centrifuge the samples at maximum speed for 5 min and remove the supernatant.
  6. Resuspend the pellet in 400 µl of nuclease-free water. Use 1/4 of the prepared probe for each blot (described below).
    Note: Ideally, fluorescent probes could be used in place of ³²P-labeled probes. However, we have not optimized the use of fluorescent probes ourselves. The sensitivity of fluorescent probes at this time can be quite a bit lower than ³²P-probes, so more RNA samples might be needed.
APB gel separation of total RNA
1. Total RNA extraction
  1. Extract total RNA from mammalian cells (e.g., Trizol method, see Reference 6)
    Note: If using RNA extraction kit, choose one that does not lose small RNAs.
  2. Measure the RNA concentration of your samples.
  3. Aliquot 5 µg or more of RNA for each analyzed sample. If not available, as low as 1 µg total RNA may be used. Keep the total volume of the RNA sample low, so the whole sample can fit in one lane after adding 2x gel loading buffer (final volume: about 20 µl, Step B2c).
2. Deacylation of RNA to remove amino acids attached to the 3’ end of tRNAs
  1. Mix the RNA with 100 mM final concentration of Tris-HCl (pH 9.0).
  2. Incubate for 30 min at 37 °C in a thermoblock.
  3. Combine deacylated RNA samples with an equal volume of denaturing 2x gel loading buffer. (Store the samples at -20 °C if needed for future use)
3. APB gel
  1. Prepare 10% urea denaturing polyacrylamide gel containing 5% 3-Acrylamidophenylboronic acid (adjust the volumes of the gel solution to the glass plates and gel spacers available in the lab).
  2. Pre-run the gel in 1x TAE buffer for 30 min (e.g., at constant 18 W using the electrophoresis apparatus listed in Equipment).
  3. Wash the wells of the gel using a syringe and 1x TAE buffer.
  4. Load your samples onto the gel.
  5. Run gel electrophoresis in 1x TAE buffer at 18 W until the first dye (BPB) reaches the bottom of the gel.
Northern blots

Gel transfer
1. After electrophoresis, take apart the glass plates.
2. Put a Hybond-XL membrane on the gel (mark the orientation of the gel).
3. Take the gel off the glass plate and create a “sandwich” as follows (from the bottom): Whatman filter paper-membrane-gel-plastic foil.
4. Transfer RNA onto the membrane using vacuum gel dryer for 2 h at 80 °C.
Pre-hybridization
1. Remove the membrane from the gel using distilled water.
2. Wash the membrane twice for 30 min each in hybridization buffer at room temperature.
Hybridization
1. Put the membrane into hybridization tubes of appropriate size (adjusted to the size of your membrane).
2. Add 15 ml of hybridization buffer per one tube.
3. Add 100 µl of the 5’ ³²P-labeled oligonucleotide probe prepared beforehand (described in Procedure A).
4. Incubate and rotate the tubes in a hybridization oven for 16 h at 60 °C.
Washing the membrane
1. Remove the hybridization buffer.
2. Wash the membranes twice for 30 min each at 60 °C in a washing solution.
3. Take the membranes out of the tubes and dry them until you don’t see any bubbles from washing solution.
Membrane exposure
Put the membranes into a cassette, cover with plastic foil and expose to phosphor screen from 6 to 16 h.
Reading the signal
Use phosphoimager to scan and quantify the intensity of detected bands with the Imager software. An example of the result is shown in Figure 2.

Figure 2. Q-modification kinetics. Time course of Q modification for tRNA^Asn starting with the addition of 1 μM queuine to 0Q cell medium (5 µg total RNA loaded in each lane).

Data analysis

Scanned gel image was analyzed with the use of Quantity One imager software.
If procedure was performed correctly, the final image should show separate bands corresponding to the Q-modified and/or G-containing fractions of the intended tRNA species (Figure 2). If larger separation is desired, run the gel for longer time while preventing running the tRNAs out using the dye migration as a guide, or use a longer gel. While performing the transferring step, make sure to cut out the section of the gel containing the tRNA molecules of interest.
When quantifying results, assume that all signals in one lane (Q-tRNA + G-tRNA) represents total tRNA of this species loaded in this lane. Calculate the fraction of Q-modified tRNAs for each sample as [Q-band]/([Q-band] + [G-band]).
For negative controls, repeat the same procedure using a probe for a tRNA not modified with Q (e.g., tRNA^Ala), which should only show one band on the APB gel.
Another control is to perform peroxide oxidation of the RNA sample first which destroys the cis-diol of the Q-base and the 3’ end of the RNA, so that the probed tRNA species runs faster than the G-band (Igloi and Kossel, 1985; Zaborske et al., 2014).

Recipes

All indicated concentrations are final concentrations of each chemical.

2x Gel loading buffer
9 M urea
100 mM EDTA
0.2% (w/v) bromophenol blue
0.2% (w/v) xylene cyanol
10% denaturing polyacrylamide gel
10% acrylamide/bis solution, 29:1
9 M urea
1x TBE
10% APB polyacrylamide gel
10% acrylamide/bis solution, 29:1
9 M urea
1x TAE
5% 3-Acrylamidophenylboronic acid
Dialyzed serum medium (HEK293T and HeLa)
DMEM
10% dialyzed FBS
Gel extraction buffer
50 mM KOAc, pH 7.0
200 mM KCl
Hybridization buffer
20 mM sodium phosphate, pH 7.0
300 mM NaCl
1% sodium dodecyl sulphate (SDS)
1 M Sodium phosphate buffer (pH 7.0)
390 mM NaH₂PO₄
610 mM Na₂HPO₄
1 M Tris-HCl buffer (pH 9.0)
1 M Tris
Adjust pH with HCl
Washing solution
20 mM sodium phosphate, pH 7.0
300 mM NaCl
0.1% SDS
2 mM EDTA

Acknowledgments

This method was based on the protocol developed previously (Zaborske et al., 2014; Wang et al., 2018). We thank the support from DoD/CDMRP (BC160450 to T.P.).

Competing interests

There are no conflicts of interest or competing interest.

References

El Yacoubi, B., Bailly, M. and de Crecy-Lagard, V. (2012). Biosynthesis and function of posttranscriptional modifications of transfer RNAs. Annu Rev Genet 46: 69-95.
Fergus, C., Barnes, D., Alqasem, M. A. and Kelly, V. P. (2015). The queuine micronutrient: charting a course from microbe to man. Nutrients 7(4): 2897-2929.
Igloi, G. L. and Kossel, H. (1985). Affinity electrophoresis for monitoring terminal phosphorylation and the presence of queuosine in RNA. Application of polyacrylamide containing a covalently bound boronic acid. Nucleic Acids Res 13(19): 6881-6898.
Rakovich, T., Boland, C., Bernstein, I., Chikwana, V. M., Iwata-Reuyl, D. and Kelly, V. P. (2011). Queuosine deficiency in eukaryotes compromises tyrosine production through increased tetrahydrobiopterin oxidation. J Biol Chem 286(22): 19354-19363.
Singhal, R. P., Kopper, R. A., Nishimura, S. and Shindo-Okada, N. (1981). Modification of guanine to queuine in transfer RNAs during development and aging. Biochem Biophys Res Commun 99(1): 120-126.
TRIzolTM Reagent RNA extraction protocol: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/trizol_reagent.pdf.
Tuorto, F., Legrand, C., Cirzi, C., Federico, G., Liebers, R., Muller, M., Ehrenhofer-Murray, A. E., Dittmar, G., Grone, H. J. and Lyko, F. (2018). Queuosine-modified tRNAs confer nutritional control of protein translation. EMBO J 37(18) pii: e99777.
Wang, X., Matuszek, Z., Huang, Y., Parisien, M., Dai, Q., Clark, W., Schwartz, M. H. and Pan, T. (2018). Queuosine modification protects cognate tRNAs against ribonuclease cleavage. RNA 24(10): 1305-1313.
Zaborske, J. M., DuMont, V. L., Wallace, E. W., Pan, T., Aquadro, C. F. and Drummond, D. A. (2014). A nutrient-driven tRNA modification alters translational fidelity and genome-wide protein coding across an animal genus. PLoS Biol 12(12): e1002015.