Materials and Reagents

Escherichia coli (E. coli) isolate UTI893
Sterile distilled, deionized water (diH₂O)
Agarose, molecular biology grade, standard sieve
Ethidium Bromide, 1 mg/ml in distilled, deionized water (diH₂O) (or other agent to visualize DNA)
Taq polymerase (1 U/μl) with 10x NH₄buffer (APEX Bioresearch Products, catalog number: 42-409 )
10 mM dNTP mix, PCR grade (Life Technologies, catalog number: 18427-013 )
Tryptone
Yeast extract
NaCl
Tris base
Boric acid
EDTA (pH 8.0)
SDS
Glycerol
Xylene cyanol
Bromophenol blue
hyxR phase-specific primers, 100 μM stock solution [Integrated DNA Technologies (IDT)]
5’ – ACTGATAATAACCAGAGGCTTCTT – 3’
5’ – CAGTGATTAACTTTCGAACATATTG – 3’
5’ – GCGAAAGTTAATCACTGGTATGACC – 3’
Tris-Borate-EDTA (TBE) (10x stock) (see Recipes)
10x DNA Loading Dye (see Recipes)
Luria-Bertani broth (LB) culture medium (Sigma-Aldrich, catalog number: L3022-250G (see Recipes)
2% TBE agarose gel with EtBr (see Recipes)
20 ml 10x DNA Loading dye⁶ (xylene cyanol/bromophenol blue) (see Recipes)

Equipment

37 °C Incubator for bacteria with aeration
Thermal cycler (Bio-Rad Laboratories)
Gel electrophoresis system (Owl Separation Systems)
UV Transilluminator with photo documentation (Bio-Rad Laboratories)

Procedure

Start 5 ml overnight culture of E. coli isolate UTI89 (Note 1) in LB at 37 °C with aeration. Culture can be started from a colony on an agar plate or from a -80 °C glycerol stock.
Setting up the phase-PCR reaction
1. Phase PCR was performed using a 1:1:1 mixture of 3 phase primers including 1) an anchor primer outside of the invertible region (primer 1); 2) a phase-specific primer for the OFF orientation (primer 2); and 3) a phase-specific primer for the ON orientation (primer 3).
  
  Reaction mixture (Note 2)
  1 μl overnight bacterial culture (template)
  2.5 μl of 10x APEX NH₄ buffer (1x final concentration)
  0.5 μl of 1 unit/μl APEX Taq polymerase (0.5 unit final concentration)
  1.25 μl of 50 mM MgCl₂ (2.5 mM final concentration)
  0.1 μl of 100 μM stock of each of 3 primers (0.4 μM final concentration of each primer)
  0.5 μl of 10 mM dNTP mix (0.2 mM final concentration)
  up to 25 μl total volume with sterile diH₂O.
2. Thermal cycler program:
Make 50 ml volume of 2% agarose in 1x TBE (see below). Pour gel into casting apparatus.
Cover gel completely with 1x TBE (running buffer).
Mix 5-10 μl of PCR reaction with 0.5-1.0 μl 10x DNA loading dye (approx. 1x final concentration). Load into wells and run samples at 100-120 V for 45 min to 1 h.
Visualize and photograph using a UV gel transilluminator.
Mixed phase populations show two bands by PCR, corresponding to the OFF and ON promoter orientations. The OFF orientation gives a 196 bp amplicon vs. a 231 bp amplicon for the ON orientation.

Notes

UTI89 is a prototypic ExPEC cystitis isolate that was obtained from an adult patient with cystitis and has been well described in the literature (Mulvey, 1998). Primers for this protocol were designed to UTI89 genomic sequence, and while ExPEC isolates are similar, their genomic sequence may not be exact. It is recommended that researchers check that the primers listed in this protocol will work with other ExPEC isolates.
All PCR reactions were performed using APEX Taq polymerase and accompanying buffers distributed by Genesse Scientific, Inc (San Diego, California, USA). Thermal cycler parameters were based on the manufacturer’s recommendations. Taq polymerase or related thermostable polymerases would be expected to provide similar performance in this assay with minor modifications of the reactions.
1x TBE is what you will use to make your agarose gel as well as the buffer used to run the gel.
Any commercially available DNA loading dye is appropriate. The recipe given is only a home-made suggestion. Other recipes available use different tracking dyes and/or density agents.

Recipes

1x LB
Suspend 20 g in 1 L of distilled water
Autoclave for 15 min at 121 °C
Final concentration of components (Tryptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L)
1 L 10x TBE buffer stock (Tris-borate-EDTA)
108 g Tris base
55 g Boric acid
40 ml 0.5 M EDTA (pH 8.0)
diH₂O to 1 L
Stir until completely dissolved
1 L 1x TBE buffer (working) (Note 3)
100 ml 10x TBE
900 ml diH₂O
Mix well
2% TBE agarose gel with EtBr
2 g agarose per 100 ml 1x TBE
Heat in microwave (approx. 2 min) until agarose is dissolved
Let stand at room temperature for 15-20 min to cool (you do not want to re-solidify)
Add EtBr to a final concentration of 0.1 μg/ml just prior to pouring gel
20 ml 10x DNA Loading dye (Note 4) (xylene cyanol/bromophenol blue)
Add 0.025 g each xylene cyanol and bromophenol blue
1.25 ml 10% SDS
12.5 ml 100% glycerol
6.25 ml H₂O
Mix thoroughly and store at room temperature

Acknowledgments

This protocol is adapted from Bateman and Seed (2012).

References

Bateman, S. L. and Seed, P. C. (2012). Epigenetic regulation of the nitrosative stress response and intracellular macrophage survival by extraintestinal pathogenic Escherichia coli. Mol Microbiol 83(5): 908-925.
Mulvey, M. A., Lopez-Boado, Y. S., Wilson, C. L., Roth, R., Parks, W. C., Heuser, J. and Hultgren, S. J. (1998). Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 282(5393): 1494-1497.