Promoter Orientation of Prokaryotic Phase-variable Genes by PCR   

Materials and Reagents

1. Escherichia coli (E. coli) isolate UTI893
   
2. Sterile distilled, deionized water (diH₂O)
   
3. Agarose, molecular biology grade, standard sieve
   
4. Ethidium Bromide, 1 mg/ml in distilled, deionized water (diH₂O) (or other agent to visualize DNA)
   
5. Taq polymerase (1 U/μl) with 10x NH₄ buffer (APEX Bioresearch Products, catalog number: 42-409 )
   
6. 10 mM dNTP mix, PCR grade (Life Technologies, catalog number: 18427-013 )
   
7. Tryptone
   
8. Yeast extract
   
9. NaCl
   
10. Tris base
    
11. Boric acid
    
12. EDTA (pH 8.0)
    
13. SDS
    
14. Glycerol
    
15. Xylene cyanol
    
16. Bromophenol blue
    
17. hyxR phase-specific primers, 100 μM stock solution [Integrated DNA Technologies (IDT)]
    5’ – ACTGATAATAACCAGAGGCTTCTT – 3’
    5’ – CAGTGATTAACTTTCGAACATATTG – 3’
    5’ – GCGAAAGTTAATCACTGGTATGACC – 3’
    
18. Tris-Borate-EDTA (TBE) (10x stock) (see Recipes)
    
19. 10x DNA Loading Dye (see Recipes)
    
20. Luria-Bertani broth (LB) culture medium (Sigma-Aldrich, catalog number: L3022-250G (see Recipes)
    
21. 2% TBE agarose gel with EtBr (see Recipes)
    
22. 20 ml 10x DNA Loading dye⁶ (xylene cyanol/bromophenol blue) (see Recipes)
    

Equipment

1. 37 °C Incubator for bacteria with aeration
   
2. Thermal cycler (Bio-Rad Laboratories)
   
3. Gel electrophoresis system (Owl Separation Systems)
   
4. UV Transilluminator with photo documentation (Bio-Rad Laboratories)
   

Procedure

1. Start 5 ml overnight culture of E. coli isolate UTI89 (Note 1) in LB at 37 °C with aeration. Culture can be started from a colony on an agar plate or from a -80 °C glycerol stock.
   
2. Setting up the phase-PCR reaction
   1. Phase PCR was performed using a 1:1:1 mixture of 3 phase primers including 1) an anchor primer outside of the invertible region (primer 1); 2) a phase-specific primer for the OFF orientation (primer 2); and 3) a phase-specific primer for the ON orientation (primer 3).
      
      
      
      Reaction mixture (Note 2)
      1 μl overnight bacterial culture (template)
      2.5 μl of 10x APEX NH₄ buffer (1x final concentration)
      0.5 μl of 1 unit/μl APEX Taq polymerase (0.5 unit final concentration)
      1.25 μl of 50 mM MgCl₂ (2.5 mM final concentration)
      0.1 μl of 100 μM stock of each of 3 primers (0.4 μM final concentration of each primer)
      0.5 μl of 10 mM dNTP mix (0.2 mM final concentration)
      up to 25 μl total volume with sterile diH₂O.
      
   2. Thermal cycler program:
      
      
      
   
   
3. Make 50 ml volume of 2% agarose in 1x TBE (see below). Pour gel into casting apparatus.
   
4. Cover gel completely with 1x TBE (running buffer).
   
5. Mix 5-10 μl of PCR reaction with 0.5-1.0 μl 10x DNA loading dye (approx. 1x final concentration). Load into wells and run samples at 100-120 V for 45 min to 1 h.
   
6. Visualize and photograph using a UV gel transilluminator.
   
7. Mixed phase populations show two bands by PCR, corresponding to the OFF and ON promoter orientations. The OFF orientation gives a 196 bp amplicon vs. a 231 bp amplicon for the ON orientation.
   

Notes

1. UTI89 is a prototypic ExPEC cystitis isolate that was obtained from an adult patient with cystitis and has been well described in the literature (Mulvey, 1998). Primers for this protocol were designed to UTI89 genomic sequence, and while ExPEC isolates are similar, their genomic sequence may not be exact. It is recommended that researchers check that the primers listed in this protocol will work with other ExPEC isolates.
   
2. All PCR reactions were performed using APEX Taq polymerase and accompanying buffers distributed by Genesse Scientific, Inc (San Diego, California, USA). Thermal cycler parameters were based on the manufacturer’s recommendations. Taq polymerase or related thermostable polymerases would be expected to provide similar performance in this assay with minor modifications of the reactions.
   
3. 1x TBE is what you will use to make your agarose gel as well as the buffer used to run the gel.
   
4. Any commercially available DNA loading dye is appropriate. The recipe given is only a home-made suggestion. Other recipes available use different tracking dyes and/or density agents.
   

Recipes

1. 1x LB
   Suspend 20 g in 1 L of distilled water
   Autoclave for 15 min at 121 °C
   Final concentration of components (Tryptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L)
   
2. 1 L 10x TBE buffer stock (Tris-borate-EDTA)
   108 g Tris base
   55 g Boric acid
   40 ml 0.5 M EDTA (pH 8.0)
   diH₂O to 1 L
   Stir until completely dissolved
   
3. 1 L 1x TBE buffer (working) (Note 3)
   100 ml 10x TBE
   900 ml diH₂O
   Mix well
   
4. 2% TBE agarose gel with EtBr
   2 g agarose per 100 ml 1x TBE
   Heat in microwave (approx. 2 min) until agarose is dissolved
   Let stand at room temperature for 15-20 min to cool (you do not want to re-solidify)
   Add EtBr to a final concentration of 0.1 μg/ml just prior to pouring gel
   
5. 20 ml 10x DNA Loading dye (Note 4) (xylene cyanol/bromophenol blue)
   Add 0.025 g each xylene cyanol and bromophenol blue
   1.25 ml 10% SDS
   12.5 ml 100% glycerol
   6.25 ml H₂O
   Mix thoroughly and store at room temperature
   

Acknowledgments

This protocol is adapted from Bateman and Seed (2012).

References

1. Bateman, S. L. and Seed, P. C. (2012). Epigenetic regulation of the nitrosative stress response and intracellular macrophage survival by extraintestinal pathogenic Escherichia coli. Mol Microbiol 83(5): 908-925.
   
2. Mulvey, M. A., Lopez-Boado, Y. S., Wilson, C. L., Roth, R., Parks, W. C., Heuser, J. and Hultgren, S. J. (1998). Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science 282(5393): 1494-1497.