DNA PCR Assays for Igh Rearrangement    

Materials and Reagents

1. Mouse spleen cells or ES-derived hematopoietic cells
   
2. DNA extraction Kit: PerfectPure DNA Cultured Cell Kit (5 PRIME, catalog number: 2302000 )
   
3. 10x PCR Buffer with KCl (Life Technologies, Applied Biosystems^®, catalog number: 4338856 )
   
4. MgCl₂ (Life Technologies, Applied Biosystems^®, catalog number: 4338856)
   
5. Taq DNA polymerase (Life Technologies, Applied Biosystems^®, catalog number: 4338856)
   
6. dNTPs (Life Technologies, Applied Biosystems^®, catalog number: 4338856)
   
7. Primers (FASMAC)
   The sequence of primers are as follows.
   a. D_HL(5’): GGAATTCG(AorC)TTTTTGT(CorG)AAGGGATCTACTACTGTG
   b. Mu0(5’): CCGCATGCCAAGGCTAGCCTGAAAGATTACC
   c. J3(3’): GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG
   
8. Agarose (UltraPure^TM Agarose) (Life Technologies, Invitrogen^TM, catalog number: 16500-100 )
   
9. Ethidium bromide (Wako Pure Chemical Industries, catalog number: 315-90051 )

Equipment

1. PCR Thermal Cycler (Veriti Thermal Cycler) (Life Technologies, Applied Biosystems^®)
   
2. Centrifuges (TOMY SEIKO, model: MX-150 )
   
3. Electrophoresis apparatus (ADVANCE, Mupid-exU)

Procedure

1. Genomic DNA was prepared for PCR by lysing mouse spleen cells (1-4 x 10⁴) or ES-derived hematopoietic cells (3-5 x 10⁵) in 75 µl elution solution. See the manufacturer's protocol (http://www.5prime.com/media/3415/perfectpure dna cultured cell manual_5prime_1064553_122010.pdf).
   
2. 20 µl PCR reactions contained 5.5 µl template (82.5 ng or less), 10 mM Tris-HCl, 50 mM KCl, 2.0 mM MgCl₂, 1 µM primers (25 mers), 200 µM dNTPs and 1 U Taq DNA polymerase.
   
3. PCR program
   a. 94 °C – 2 min
   b. 94 °C – 1 min
   c. 60 °C – 1 min
   d. 72 °C – 1.75 min
   e. Repeat steps b-d, 35x
   f. 72 °C – 10 min
   
4. Half of each PCR products were electrophoresed on 1% agarose gels, and their amounts were evaluated by staining with ethidium bromide.
   
5. D_H-J_H recombination was detected as amplified fragments of 1,033 bp, 716 bp and 333 bp using a primer D_HL(5’) and J3(3’). Germline alleles were detected as an amplified fragment of 1,259 bp using a primer Mu0(5’) and J3(3’).
   

Results

Figure 1.DNA PCR assays of germline (GL) or D_H-J_H rearranged Igh chain (DJ) genes were performed with mouse splenocytes. A PCR experiment using a primer D_HL(5’) and J3(3’) can detect three types of D_H-J_H rearrangement (J1, J2, and J3) (Schlissel et al., 1991). All of three bands are present with successful D_H-J_H rearrangement. However, a J1 band is sometimes undetected in the ethidium bromide-based DNA-band visualization when the amount of template DNA is very small. The size marker was loaded in the left lane.

Acknowledgments

This protocol was adapted from a previously published paper by Schlissel et al. (1991). The representative data shown in the protocol was adapted from Satoh et al. (2013).

References

1. Satoh, Y., Yokota, T., Sudo, T., Kondo, M., Lai, A., Kincade, P. W., Kouro, T., Iida, R., Kokame, K., Miyata, T., Habuchi, Y., Matsui, K., Tanaka, H., Matsumura, I., Oritani, K., Kohwi-Shigematsu, T. and Kanakura, Y. (2013). The Satb1 protein directs hematopoietic stem cell differentiation toward lymphoid lineages. Immunity 38(6): 1105-1115. 
   
2. Schlissel, M. S., Corcoran, L. M. and Baltimore, D. (1991). Virus-transformed pre-B cells show ordered activation but not inactivation of immunoglobulin gene rearrangement and transcription. J Exp Med 173(3): 711-720.