Row-cost and Multiplexable Whole mRNA-Seq Library Preparation Method   

How to cite Favorites Q&A Share your feedback Cited by

In this protocol

Original research article

A brief version of this protocol appeared in:
eLIFE
Sep 2017

 

Abstract

RNA-Seq is a powerful method for transcriptome analysis used in varied filed of biology. Although several commercial products and hand-made protocols enable us to prepare RNA-Seq library from total RNA, their cost are still expensive. Here, we established a row-cost and multiplexable whole mRNA-Seq library preparation method for illumine sequencers. In order to reduce cost, we used cost-effective and robust commercial regents with small reaction volumes. This method is a whole mRNA-Seq, which can be applied even to non-model organisms lacking the transcriptome references. In addition, we designed large number of 3′ PCR primer including 8 nucleotides barcode sequences for multiplexing up to three hundreds samples. Our protocol is beneficial for large scale transcriptome analysis in many fields of animals and plant biology.

关键词: RNA-Seq, mRNA, Multiplexing, Transcriptome, Illumina

Background

In the last decade, sequencing cost has been reduced drastically thanks to the advance in massive parallel sequencing technologies (Muir et al., 2016). On the other hand, the cost at library preparation step stands out. For example, commercial kits for RNA-Seq library preparation such as TruSeq RNA Library Prep Kit (illumine, USA) and NEBNext Ultra RNA Library Prep Kit (NEB, USA) costs about 40~60 dollars per sample. Recently, several studies have developed cost-effective RNA-Seq library preparation methods (Kumar et al., 2012; Nagano et al., 2015; Townsley et al., 2015; Alpern et al., 2019; Kamitani et al., 2019). Particularly, 3′ RNA-Seq protocols (Lasy-Seq and BRB-Seq), enables us to early-pooling of samples resulting in reducing the cost into about two dollar per sample (Alpern et al., 2019; Kamitani et al., 2019;). While 3′ RNA-Seq is economically superior to whole mRNA-Seq method, whole mRNA-Seq can sequence full-length of RNA, resulting in detection of splicing variants and novel transcripts. Although our previously-developed protocol of whole mRNA-Seq using rRNA depletion is cheap (Nagano et al., 2015), it requires many kinds of antisense oligo against rRNA and enzymes for reverse transcription, 2nd strand synthesis, end-repair, A-tailing, adapter ligation and library amplification. In this protocol, we replaced rRNA depletion against mRNA-purification using oligo-dT beads in order to reduce initial cost. Also, enzymes required from end-repair to library amplification were replaces with KAPA Hyper Prep Kit (Roche, Switzerland); this simplification increased reaction efficiency as well as reduce labor. In addition, we save reaction volumes throughout all steps (≤ 20 µl), which saved cost and enabled handling even with 384-well plates. Our protocols provide 300 kinds of 3′ PCR primers with barcode sequences for multiplexing.

Materials and Reagents

  1. Nuclease-free 0.2 ml PCR tubes
  2. Nuclease-free pipette tips
  3. 5× Super Script IV buffer (Invitrogen, catalog numbers: 18090010, 18090050 and 18090200)
  4. DTT (Invitrogen, catalog numbers: 18090010, 18090050 and 18090200)
  5. Dynabeads® Oligo (dT)25 (Thermo Fisher scientific, catalog numbers: 61002 and 61005)
  6. User-supplied total RNA
  7. Random primer (N)6 (TaKaRa, catalog numbers: 3801)
  8. Advantage® UltraPure dNTP Combination Kit (100 mM each dNTP) (TaKaRa, catalog numbers: Z9132N)
  9. SuperScript IV (Invitrogen, catalog numbers: 18090010, 18090050 and 18090200)
  10. Actinomycin D (1,000 ng/μl) (Nacalai Tesque, catalog numbers: 00393-41)
  11. AMPure XP (Beckman Coulter, catalog numbers: A63880, A63881 and A63882)
  12. Ethanol (EtOH) (Wako, catalog numbers: 052-07221 and 054-07225)
  13. Nuclease free water
  14. 10× Blue Buffer (Enzymatics, catalog numbers: P7050L)
  15. RNase H (Enzymatics, catalog numbers: Y9220L)
  16. DNA polymerase I (Enzymatics, catalog numbers: P7050L)
  17. KAPA Hyper prep kit for Illumina (KAPA Biosystems, catalog numbers: KK8500, KK8502 and KK8504)
  18. Nuclease-free Tris-HCl, 1M, pH = 7.6 (Nacalai Tesque, catalog numbers: 35436-01)
  19. LiCl (Wako, catalog numbers: 123-01162, 125-01161 and 127-01165)
  20. EDTA2Na (Wako, catalog numbers: 343-01861 and 345-01865)
  21. DNA glycosylase (UDG) (Enzymatics, catalog numbers: G5010L)
  22. KAPA HiFi HotStart ReadyMix (2×) (KAPA Biosystems, catalog numbers: KK8500, KK8502 and KK8504)
  23. KAPA Library Quantification Kit for Illumina (KAPA Biosystems, catalog numbers: KK4824 and KK4828) 
  24. Agilent High Sensitivity DNA kit (Agilent Technologies, catalog numbers: 5067-4626)
  25. 2× binding buffer (see Recipes)
  26. Washing buffer (see Recipes)

Equipment

  1. MagnaStand YS-model (FastGene, catalog numbers: FG-SSMAG2)
  2. Agilent 2100 Bioanalyzer (Agilent Technologies)
  3. Quantitative PCR instrument
  4. Pipette
  5. Thermal cycler

Procedure

In this protocol, we used the MagnaStand YS-model (FastGene) for nucleotide acid purification employing magnetic beads. All experiments were conducted in 0.2 ml PCR tubes.

  1. mRNA purification
    1. Wash 15 μl of Dynabeads® Oligo (dT)25 (Thermo Fisher scientific) with 50 μl 2x binding buffer (40 mM Tris-HCl, pH 7.6, 2 M LiCl, 4 mM EDTA) twice using the Magna Stand for 0.2 ml PCR Tube (FastGene) and resuspend in 30 μl of 2× binding buffer for later use.
      ‘Wash’ implies:
      Leave on magnet for 5 min and remove the supernatant.

      Add 2× binding buffer and mix by pipetting.

      Repeat.
    2. Denature 1 μg of total RNA in 30 μl of distilled water at 65 °C for 2 min and then immediately let it chill on ice. Add 30 μl of washed Dynabeads® Oligo (dT)25. Mix the RNA and beads well by pipetting and incubating at 20-25 °C for 10 min. Wash the mixture with 70 μl washing buffer (10 mM Tris-HCl, pH 7.6, 0.15 M LiCl, 1 mM EDTA) twice using the Magna Stand.
      ‘Wash’ implies:
      Leave on magnet for 5 min and remove the supernatant.

      Add wash buffer and mix by pipetting.

      Repeat.
    3. Elute RNA in 30 μl pre-warmed distilled water at 80 °C for 5 min and then immediately chill on ice. Then add 30 μl of 2× binding buffer and incubate at 20-25 °C for 10 min. Wash the mixture again with 70 μl washing buffer twice using the Magna Stand. Elute the RNA in 14 μl pre-warmed distilled water at 80 °C for 2 min, then immediately place it on the magnet and collect in a new tube.

  2. RNA-seq library preparation and sequencing
    1. Mix 5 μl of purified mRNA obtained as specified previously with 4 μl of 5× Super Script IV buffer (Invitrogen) and 1 μl of 100 mM DTT (Invitrogen). 
    2. mRNA fragmentation should be carried out at 94 °C for 4.5 min and the mRNA should be immediately cooled on ice. 
    3. Add 0.6 μl of 100 μM random primer (N)6 (TaKaRa) and 0.9 μl of distilled water to the mixture. 
    4. Incubate the mixture at 50 °C for 5 min and immediately chill on ice to allow RNA secondary structures to relax.
    5. Mix the fragmented RNA with a random hexamer and a reverse transcription master mix (1 μl of 100 mM DTT, 0.4 μl of dNTP (25 mM each) (Takara); 0.1 μl of SuperScript IV (Invitrogen); 0.2 μl of Actinomycin D (1,000 ng/μl) (Nacalai Tesque); and 5.9 μl of distilled water). 
    6. For the reverse transcription reaction, incubate the mixture at 25 °C for 10 min, followed by 10 min at 50 °C. SuperScript IV is inactivated by heating the mixture at 80 °C for 15 min. Then, 24 μl of AMPure XP (Beckman Coulter) and 12 μl of 99.5% EtOH are added and purification is performed as below:
      Mix by pipetting.

      Incubate at 20-25 °C for 5 min.

      Leave on magnet for 5 min then remove supernatant.

      Add 70 µl of 70% EtOH on the magnet stand and discard. Repeat this step.

      Dry for 1 min.

      Add 10.0 µl of Nuclease free water and mix by pipetting.

      Incubate at 20-25 °C for 1 min.

      Leave on magnet and collect 10.0 µl or a different volume of supernatant to a 384 well PCR plate.
    7. Elute the transcription product in 10 μl of distilled water. Mix the purified DNA/RNA hybrid solution without beads and the second strand synthesis master mix (2 μl of 10× Blue Buffer (Enzymatics), 1 μl of dUTP/NTP mix (Fermentas), 0.5 μl of 100 mM DTT, 0.5 μl of RNase H (Enzymatics), 1 μl of DNA polymerase I (Enzymatics), and 5 μl of distilled water). Incubate the mixture at 16 °C for 4 h. For purification use 24 μl of AMPure XP according to the manufacturer’s manual. Elute the purified dsDNA with 10 μl distilled water. Use 5 μl of the dsDNA solution for the following step. 
    8. End-repair, A-tailing, and adapter ligation are carried out using a KAPA Hyper prep kit (KAPA Biosystems) with 1/10× solutions volume according to the manufacturer’s manual. 1 μl of 0.1 μM Y-shape adapter (Nagano et al., 2015) is used in the adapter ligation step for 15 min.

  3. Y-shape adapter
    1. Anneal
      5′-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T-3′ and 5′-/5Phos/-G*A*TCGGAAGAGCACACGTCTGAACTCCAGTC*A*C-3′.
      * signifies a phosphonothioate bond. /5Phos/signifies phosphorylation.
      A mixture of 100 mM adapter Fw and Rev is annealed using a thermal cycler with the following program:
      95 °C for 2 min, slow-cooled to 25 °C (0.1 °C/s), followed by 30 min at 25 °C. The annealed adapter (50 μM) is diluted to 0.1 μM with distilled water and stored at -20 °C.
    2. Size selection of the ligation product is then performed with 5.5 μl of AMPure XP. Elute the purified dsDNA using 10 μl distilled water. The second round of size selection is performed with 10 μl of AMPure XP. Elute the size-selected ligation product with 15 μl of 10 mM Tris-HCl, pH 8.0. Add 1 μl of uracil DNA glycosylase (UDG) (Enzymatics) to the size-selected ligation product. 
    3. Incubate the mixture at 37 °C for 30 min to exclude second-stranded DNA. 
    4. For library amplification, mix 2 μl of the UDG-digested DNA, 1 μl of 2.5 μM index primer (CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGT, XXXXXXXX indicates index sequence in the supplemental file) (Nagano et al., 2015), 1 μl of 10 μM universal primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) (Nagano et al., 2015), 0.5 μl of distilled water and 5 μl of KAPA HiFi HotStart ReadyMix (2×) (KAPA Biosystems).
    5. Amplify DNA fragments with adapters and an index sequence using a thermal cycler with the following program: denature at 94 °C for 2 min, 18 cycles at 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s as an amplification step, and 72 °C for 5 min for final extension. Perform two rounds of size selection to remove the adapter dimer with an equal volume of AMPure XP to the library solution and 10 µl of distilled water for elution. Elute the purified library with 10 μl distilled water. Now, pool the libraries, if needed. Additionally, the library quantification kit (ex. KAPA Library Quantification Kit Illumina (KAPA Biosystems)) can be used to determine concentration followed by pooling.
    6. Perform electrophoresis with 1 μl of purified library using an Agilent High Sensitivity DNA kit (Agilent Technologies) to evaluate quality. 

Recipes

  1. 2× binding buffer
    40 mM Tris-HCl, pH 7.6
    2 M LiCl
    4 mM EDTA
  2. Washing buffer
    10 mM Tris-HCl, pH 7.6
    0.15 M LiCl
    1 mM EDTA

Acknowledgments

This work was supported by the JST CREST JPMJCR15O2 to A.J.N. This protocol was modified from one described in Nagano et al., 2015. We would like to thank Editage (www.editage.com) for English language editing.

Competing interests

We have no conflicts of interest or competing interests.

References

  1. Alpern, D., Gardeux, V., Russeil, J., Mangeat, B., Meireles-Filho, A. C. A., Breysse, R., Hacker, D. and Deplancke, B. (2019). BRB-seq: ultra-affordable high-throughput transcriptomics enabled by bulk RNA barcoding and sequencing. Genome Biol 20(1): 71.
  2. Kamitani, M., Kashima, M., Tezuka, A. and Nagano, A. J. (2019). Lasy-Seq: a high-throughput library preparation method for RNA-Seq and its application in the analysis of plant responses to fluctuating temperatures. Sci Rep 9(1): 7091.
  3. Kumar, R., Ichihashi, Y., Kimura, S., Chitwood, D. H., Headland, L. R., Peng, J., Maloof, J. N. and Sinha, N. R. (2012). A high-throughput method for Illumina RNA-Seq library preparation. Front Plant Sci 3: 202.
  4. Muir, P., Li, S., Lou, S., Wang, D., Spakowicz, D. J., Salichos, L., Zhang, J., Weinstock, G. M., Isaacs, F., Rozowsky, J. and Gerstein, M. (2016). The real cost of sequencing: scaling computation to keep pace with data generation. Genome Biol 17: 53.
  5. Nagano, A. J., Honjo, M. N., Mihara, M., Sato, M. and Kudoh, H. (2015). Detection of plant viruses in natural environments by using RNA-Seq. Methods Mol Biol 1236: 89-98. 
  6. Townsley, B. T., Covington, M. F., Ichihashi, Y., Zumstein, K. and Sinha, N. R. (2015). BrAD-seq: Breath Adapter Directional sequencing: a streamlined, ultra-simple and fast library preparation protocol for strand specific mRNA library construction. Front Plant Sci 6: 366.
Copyright Kashima et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
引用格式:Makoto Kashima, Ayumi Deguchi, Ayumi Tezuka, Atsushi J. Nagano. (2019). Row-cost and Multiplexable Whole mRNA-Seq Library Preparation Method. Bio-101: e3496. DOI: 10.21769/BioProtoc.3496.
How to cite: Ishikawa, T., Kashima, M., Nagano, A. J., Ishikawa-Fujiwara, T., Kamei, Y., Todo, T. and Mori, K. (2017). Unfolded protein response transducer IRE1-mediated signaling independent of XBP1 mRNA splicing is not required for growth and development of medaka fish. eLife 6: e26845. (2019). Row-cost and Multiplexable Whole mRNA-Seq Library Preparation Method. Bio-101: e3496. DOI: 10.21769/BioProtoc.3496.
Q&A

Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data including images for the troubleshooting.

You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.