Single-cell RNA library preparation

Modified CEL-Seq2 protocol for single cell RNA sequencing on sorted Drosophila neurons

This protocol is based on published CEL-Seq2 and DIVA-seq (Paul and Huang 2018; Hashimshony et al. 2016; Paul et al. 2017).

Note: Since you started with very little RNA from single cells, be very careful of the contaminations. Use RNaseZap to clean all the pipettes, racks, mini centrifuge and bench in the PCR hood, change your gloves more often during the procedure.

Reagents:

Non-stick RNase-free 1.5 tubes

RNase free water

Ethanol

ERCC RNA spike-in mix – Ambion 4456740 

dNTPs mix 10mM

SuperScript II – Invitrogen 18064-014

RNaseOUT – Invitrogen 10777-019

Second strand buffer – Invitrogen 10812-014

DNA Polymerase I (E. coli) – Invitrogen 18010-025

E. coli DNA ligase – Invitrogen 18052-019

RNaseH (E. coli) – Invitrogen 18021-071

MEGAscript T7 Transcription Kit – Ambion AM1334

ExoSAP-IT For PCR Product Clean-Up – Affymetrix 78200

Fragmentation buffer: 200mM Tris-acetate, pH 8.1, 500 mM KOAc, 150 mM MgOAc

Fragmentation stop buffer: 0.5 M EDTA pH8

AMPure XP beads – Beckman Coμlter A63880

RNAClean XP beads – Beckman coμlter A63987

Bead binding buffer – 20% PEG8000, 2.5M NaCl

NEBNext® Magnesium RNA Fragmentation Module – E6150S

Phusion® High-Fidelity PCR Master Mix with HF Buffer – NEB M0531

Random hexRT primer – GCCTTGGCACCCGAGAATTCCANNNNNN

RNA PCR primers (sequences available from Illumina)

2nd Round Primer – NNNNNN

T7-RA5 primer – GCCGGTAATACGACTCACTATAGGGAGTTCTACAGTCCGACGATC

Equipment:

Flow Cytometer 

Eppendorf EPmotion liquid handler

Thermocycler with lid with adjustable temperature 

Magnetic stand

Centrifuges

Agilent Tape station

Primers:

CEL-Seq2 primer design: The RT primer was designed with an anchored polyT, a 6 bp unique barcode, a 6 bp UMI (unique molecular identifier), the 5’ Illumina adapter (as used in the Illumina small RNA kit) and a T7 promoter. The barcodes were designed such that each pair is different by at least two nucleotides, so that a single sequencing error will not produce the wrong barcode. Primers are desalted at the lowest possible scale, stock solution 1 μg/μl, working concentration 25 ng/μl. If not using all 48 primers, it is recommended to pool at least 10, and use the following barcodes: 1, 4, 5, 9, 10, 23, 25, 26, 31, 46.

Preparing samples for single-cell sequencing

1. Prepare eight 384-well plates with primers
   1. Prepare mix without primers and aliquot 20 μl into each well of a 96-well plate.
      Primer Mix          1x       8 plates
      ERCC Spike-in       4 μl     400 μl
      dNTPs 10mM        2 μl     200 μl
      RNase free water  14 μl    1400 μl
      Spike-in dilution should be appropriate for sample size – see protocol of ERCC RNA spike in mix. For single cells we add the equivalent of 1μl of spike-in at 1:1,000,000 dilutions.
   2. Add 4 μl of each primer (25 ng/μl) to different wells. Pipette up and down to mix. Seal plate and spin down briefly at 4 ^oC. 
   3. Aliquot 0.6 μl primer mix to eight 384-well plates. Seal plates, spin down briefly, and store in -80 °C until ready for use.
2. Sort the cells with FACS machine
   1. Sort the neurons into 384-well plate by FACS machine, leave some wells empty as negative controls. Spin the plate at 3500 g for 5 min at 4 ^oC and store in -80 ^oC.

Library Prep:  Day 1

1. Lyse cells
   1. Remove the plate from -80 °C and go straight to a 5 min incubation at 65°C. Immediately move plate to ice for 2 min. 
   2. Spin down at 3500g for 3 min to collect as many droplets as possible and return to ice.
2. First strand synthesis
   1. Add 0.4 μl first strand mix to each well. Spin plate down at 3500g for 3 min.
      First Strand Mix         1x           1 plate       2 plates
      First Strand buffer      0.20 μl      80 μl          160 μl
      DTT 0.1M                    0.10 μl      40 μl          80 μl
      RNase Inhibitor          0.05 μl       20 μl          40 μl
      Superscript II              0.05 μl       20 μl          40 μl
                                                      [40 μl/well in 8-well strip]
   2. Incubate for 2 hours at 42 ^oC.
   3. Heat inactivates for 10 min at 70 ^oC. 
3. Second strand synthesis
   1. Add 5 μl second strand mix to each well. Spin plate down briefly.
      Second Strand Mix                1x             1 plate           2 plates
      mH₂O                                     3.5 μl         1512 μl            3024 μl
      5X Second strand buffer        1.155 μl     498.96 μl         997.92 μl
      dNTP                                       0.115 μl     49.68 μl           99.36 μl
      ligase                                      0.04 μl       17.28 μl           34.56 μl
      E. coli DNA Pol                       0.15 μl        64.8 μl             129.6 μl
      RNase H                                 0.04 μl        17.28 μl           34.56 μl
                                                                  [270 μl/well in 8-well strip]
   2. Incubate for 2 hrs at 16^oC in a thermal cycler.
   3. Pool reactions of the same libraries together into 1.5 ml tubes, we make 4 libraries from a 384-well plate.
4. cDNA cleanup
   1. Prewarm AMPure XP beads to room temperature.
   2. Add 35 μl AMPure beads and enough bead binding buffer to 0.8X volume of each sample to each tube. 
   3. Incubate at room temperature for 10 min.
   4. Place on magnetic stand for 15 min or until liquid appears clear.
   5. Discard the supernatant.
   6. Add 200μl freshly prepared 80% EtOH and transfer the suspension to a PCR tube. 
   7. Place it on magnetic stand for 2 min or until liquid appears clear.
   8. Discard supernatant.
   9. Add 200 μl freshly prepared 80% EtOH and incubate for 30 seconds.
   10. Discard supernatant without disturbing beads and air-dry beads for 2 min.
   11. Resuspend with 8 μl water. Pipette up and down to mix thoroughly.
   12. Incubate at room temperature for 2 min.
   13. Place on magnetic stand for 2 min or until liquid appears clear.
   14. Transfer 6.4 μl supernatant to a new tube and go straight to First Round IVT.
   15. Add 12 μl H₂O to the remaining sample on a magnetic stand, pipette up and down to mix well, then do a qPCR of RpL32 or any other housekeeping genes as quality control.
5. First round in-vitro transcription
   1. Add 9.6 μl IVT mix to each tube
      IVT Mix                  1x                    8 libraries
      A                           1.6 μl               13 μl
      G                           1.6 μl               13 μl
      C                           1.6 μl               13 μl
      U                           1.6 μl               13 μl
      10X T7 buffer       1.6 μl                13 μl
      T7 enzyme            1.6 μl               13 μl
   2. Incubate in thermocycler at 37 ^oC for 16 hrs with lid at 70^oC. Set thermocycler to hold at 4 ^oC after incubation. aRNA is stable for several hours.
       

Library Prep: Day 2

1. Exo-SAP treatment to remove free primers
   1. Add 6 μl enzyme
   2. Incubate at 37 ^oC for 15 min.
2. aRNA cleanup
   1. Prewarm RNAClean XP beads to room temperature.
   2. Add 17.6 μl RNAClean XP beads to the sample.
   3. Incubate at room temperature for 10 min.
   4. Place on magnetic stand for at least 2 min or until liquid appears clear.
   5. Remove and discard the supernatant.
   6. Do two washes.
      1. Add 200 μl freshly prepared 70% EtOH.
      2. Incubate for 30 seconds and discard supernatant without disturbing beads.
   7. Air dry beads for 2 min.
   8. Resuspend with 10 μl water. Pipette up and down to mix thoroughly.
   9. Incubate at room temperature for 2 min.
   10. Place on magnetic stand for 2 min, until liquid appears clear.
   11. Transfer 8 μl supernatant to new tube.
3. First strand synthesis
   1. Add 2 μl 2nd Round Primer (prepare 10uM fresh), vortex briefly, and spin to collect.
   2. Incubate at 70 ^oC for 10 min in a thermocycler and place tubes on ice for 2 min.
   3. Prepare RT first strand mix and place on ice.
      RT First Strand Mix                         1x              8 libraries
      5X First strand synthesis buffer         4 μl            34 μl
      DTT 0.1M                                           2 μl            17 μl
      dNTP mix                                           2 μl            17 μl
      RNase OUT                                         1 μl            8.5 μl
      Superscript II                                      1 μl             8.5 μl                                 
   4. Add 10 μl of RT First Strand Mix to each tube. 
   5. Incubate tubes at 25 ^oC for 10 min then 42 ^oC for 2 hrs.
   6. Add 1 μl of RNase H to each tube. Mix well by pipetting 2-3 times and flicking 3-4 times; spin to collect.
   7. Incubate at 37 ^oC for 30 min.
   8. After incubation go straight to second strand synthesis. 
4. Second strand synthesis
   1. Add 2 μl of 10 μM T7-RA5 primer (prepare fresh) to each cDNA sample. Mix well, spin to collect.
   2. Incubate at 70 ^oC for 10 min in a thermal cycler. Place reaction on ice for 2 minutes.
   3. Prepare the RT master mix – second strand:
      RT Second Strand Mix             1x            8 libraries
      Nuclease free water                 51 μl          413.1 μl
      5X Second strand buffer          20 μl          162 μl
      dNTP mix                                  4 μl           32.4 μl
      DNA polymerase                      2 μl           1. 6.2 μl
   4. Mix well and spin to collect; keep on ice.
   5. Add 77 μl of the above mix to each 23 tube. Mix well by pipetting 2-3 times and flicking 3-4 times, spin to collect; keep on ice and hold.
   6. Pre-cool the thermal cycler to 16 ̊C turn off lid heat; Place tubes for 2 hrs at 16 ̊C.
5. cDNA cleanup
   1. Prewarm AMPure XP beads to room temperature.
   2. Add 40 μl AMPure XP beads and 40 μl bead binding buffer to sample.
   3. Incubate at room temperature for 10 min.
   4. Place on magnetic stand for at least 2 min or until liquid appears clear.
   5. Remove and discard the supernatant.
   6. Do two washes.
      1. Add 200 μl freshly prepared 80% EtOH.
      2. Incubate for 30 seconds and discard supernatant without disturbing beads.
   7. Air dry beads for 2 min.
   8. Resuspend with 7.5 μl water. Pipette up and down to mix thoroughly.
   9. Incubate at room temperature for 2 min.
   10. Place on magnetic stand for 2 min, until liquid appears clear.
   11. Transfer 6.4 μl supernatant to a new tube and go straight to 2nd Round IVT.
   12. Add 12 μl H₂O to the remaining sample on a magnetic stand, pipette up and down to mix well, then do a qPCR of RpL32 or any other housekeeping genes as quality control.
6. 2^nd round in-vitro transcription
   1. Add 9.6 μl IVT mix to each tube
      IVT Mix            1x                    8 libraries
      A                       1.6 μl               13 μl
      G                       1.6 μl               13 μl
      C                        1.6 μl               13 μl
      U                        1.6 μl               13 μl
      10X T7 buffer     1.6 μl               13 μl
      T7 enzyme         1.6 μl               13 μl
   2. Incubate in thermocycler at 37^oC for 16 hrs with lid at 70^oC. Set thermocycler to hold at 4 ^oC after incubation. aRNA is stable for at least several hours.

Library Prep: Day 3

1. EXO-SAP treatment to remove free primers
   a. Add 6 μl enzyme
   b. Incubate at 37 oC for 15 min.
2. RNA fragmentation
   1. On ice, add 2.5 μl Fragmentation Buffer to your sample and mix thoroughly.
   2. Incubate for 3.5 min at 94 ^oC. 
   3. Immediately move to ice and add 2.5 μl Fragmentation Stop Buffer.
3. aRNA cleanup
   1. Prewarm RNAClean XP beads to room temperature.
   2. Add 21.6 μl RNAClean XP beads to sample (0.8X volume).
   3. Incubate at room temperature for 10 min.
   4. Place on magnetic stand for at least 2 min or until liquid appears clear.
   5. Remove and discard the supernatant.
   6. Do two washes.
      1. Add 200 μl freshly prepared 70% EtOH.
      2. Incubate for 30 seconds and discard supernatant without disturbing beads.
   7. Air dry beads for 2 min.
   8. Resuspend with 10 μl water. Pipette up and down to mix thoroughly.
   9. Incubate at room temperature for 2 min.
   10. Place on magnetic stand for 5 min, until liquid appears clear.
   11. Transfer 5 μl supernatant to a new tube.
4. Check aRNA amount and quality (TapeStation)
   1. For each sample, mix 1μl aRNA, 1μl H₂O, and 1μl sample buffer.
   2. Incubate at 72 ^oC for 3 min and keep on ice for 2 min.
   3. Keep the rest of the aRNA until libraries are done.
5. Reverse transcription
   1. Add 1 μl Random hexRT primer (prepare 10uM fresh), and 0.5 μl dNTPs to each sample.
   2. Incubate for 5 min at 65 ^oC and quickly chill on ice.
   3. Add 4 μl RT mix to each reaction at room temperature:
      RT Mix                      1x         8 libraries
      First strand buffer     2 μl        17 μl
      DTT 0.1M                  1 μl         8.5 μl
      RNaseOUT                0.5 μl      4.25 μl
      Superscript II            0.5 μl       4.25 μl
   4. Incubate for 10 min at 25 ^oC.
   5. Incubate 2 hrs at 42 ^oC.
6. PCR amplification
   1. Add 38 μl PCR master mix to each reaction: 
      PCR Mix                                                        1x            8 libraries
      mH₂O                                                             11 μl        89.1 μl
      PCR mix                                                          25 μl        202.5 μl
      RNA PCR Primer (RP1, from Illumina kit)       2 μl          16.2 μl
   2. Add 2 μl of a uniquely indexed RNA PCR Primer (RPIX, sequences from Illumina kit) to each reaction.
   3. Amplify the library in the thermal cycler using the following PCR cycling conditions:
      30 seconds at 98 °C
      n cycles of: 
      10 seconds at 98 °C 
      30 seconds at 60 °C 
      30 seconds at 72 °C
      10 minutes at 72 °C
      Hold at 4 °C
      Depends on the amount of fragmented RNA, use appropriate number of cyclers to amplify the library. We use 7 to 10 cycles typically, if aRNA concentration was low, it can go up to 15 cyles if necessary.
7. Size selection
   1. Prewarm AMPure XP beads to room temperature.
   2. Add 40 μl AMPure XP beads to the 50 μl PCR reaction 
   3. Incubate at room temperature for 15 min.
   4. Place on magnetic stand for at least 5 min, until liquid appears clear.
   5. Remove and discard the supernatant.
   6. Do two washes.
      1. Add 180 μl freshly prepared 80% EtOH.
      2. Incubate for 30 seconds and discard supernatant without disturbing beads.
   7. Air dry beads for 2 min, or until completely dry.
   8. Resuspend with 27 μl water. Pipette entire volume up and down to mix thoroughly.
   9. Incubate at room temperature for 5 min.
   10. Place on magnetic stand for 5 min, until liquid appears clear.
   11. Transfer 25μl of supernatant to new tube.
   12. Repeat a – k, adding 20 μl beads, eluting in 16 μl mH2O, and transferring 14 μl to a new tube.
   13. Check library amount and quality on Agilent Tapestation with a D1000 high sensitivity tape. 

Reference

Hashimshony, Tamar, Naftalie Senderovich, Gal Avital, Agnes Klochendler, Yaron de Leeuw, Leon Anavy, Dave Gennert, et al. 2016. “CEL-Seq2: Sensitive Highly-Multiplexed Single-Cell RNA-Seq.” Genome Biology 17 (April): 77.

Paul, Anirban, Megan Crow, Ricardo Raudales, Miao He, Jesse Gillis, and Z. Josh Huang. 2017. “Transcriptional Architecture of Synaptic Communication Delineates GABAergic Neuron Identity.” Cell 171 (3): 522–39.e20.

Paul, Anirban, and Z. Josh Huang. 2018. “Single-Cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq).” Journal of Visualized Experiments: JoVE, no. 140 (October). https://doi.org/10.3791/58690.