Crispr-CAS9 knockout of Piezo1

Crispr KO of Piezo1 in Hb9-GFP cells (mES cells)

1. Sequence the region of interest in the target cell line (mES cells)

1. Search NCBI databases to obtain the published sequence of the gene of interest, and design PCR primers surrounding the region.
2. Extract DNA from mES cells using QuickExtract DNA Extraction solution (Epicentre).
3. Use the primers designed in 1 to PCR and fully sequence the region of interest.

2. Find a good target region for Cas9

1. Use this site http://crispr.mit.edu:8079/ to find a good target region at the beginning of the gene. The algorithm will output multiple regions, choose 2-3 target regions with high scores (i.e. >85) and low off target effects in other genes.

2. We used the following guides, ACGCTTCAATGCTCTCTCGC and AGAGAGCATTGAAGCGTAAC, both located in the beginning of the second exon of the mouse Piezo1 gene.

3. Generate Cas9 construct by cloning guide RNA into px459

1. Digest px459 with BbsI. (Do not phosphatase treat) 2 µl 10X RE Buffer (e.g. NEB Buffer 2.1)
   16 µl H₂O
   1 µl pX330 (1µg/µl) 1 µl BbsI
   37ºC for 1 hr
2. Anneal oligos:
   Add 5ul of 10uM FWD oligo Add 5ul of 10uM REV oligo 90ul dH₂O
   Heat to 95 degrees for 3-5 min
   Let reaction cool at room temp for 30 min to 1 hr Proceed with 1ul for reaction below
3. Add ligation components directly to digest.
   2.5 µl 10X T4 Ligase Buf
   1 µl annealed oligo (10 µM stock; 0.4 µM final concentration)
   1.5 µl T4 DNA ligase 37ºC for 1 hr.
4. Transform 8-10 µl directly from above reaction, One Shot Stbl3 bacteria (Invitrogen #C7373-03)
5. Pick ~ 4-6 colonies for each gRNA
6. Sequence DNA using U6 primer: 5’ ACTATCATATGCTTACCGTAAC

4. Puromycin titration for mES cells

Culture mEC cells in 2i + LIF media so that you don’t need to grow them on feeder cells. In naive cells, do a titration of puromycin to determine the optimal concentration for selection. For this, plate them in 24 well plates and apply puromycin from 0 to 10 uM. The optimal concentration for selection is the minimal one that causes all cells to die.

Note: I strongly suggest doing a puromycin titration and not relying on reported values, I found that even the same cell type in different labs show quite a bit of variation. For example, when I did it for the HEK293t strand that we had in lab I found the optimal concentration to be 5uM, which was higher than the published 1uM for other strands. For the mES cell line we used it was 1uM.

5. mES cell transfection and selection

1. Plate mES cells on 6 wells of a 12 well plate using lipofectamine. We used 2 wells per construct to try, and we had 2 constructs (one for each guide RNA). 2 more wells were transfected with control.
2. Transfect using lipofectamine 2000 (later on we had better success with 3000), one well per construct. Also transfect 2 wells with control Crispr plasmid (for control we used the px construct with GPF instead of Puromycin).
3. Select 2 days with Puromycin. The wells with the construct should have some survivors (not many) and the wells with control GFP plasmid should be entirely dead. If not, repeat titration.
4. After selection, let cells recover in fresh media without Puromycin for 1 day.
5. Dissociate and put the entire content of each well of the 12 well plate into 10cm dishes, with feeders. We don’t want to lose any survivors!
6. Wait 1 week, or until colonies look good, established but still isolated. Check cells periodically and identify single cells that are forming good colonies. It is very important that the colonies come from single cells to ensure genetic homogeneity.

6. Isolation of clonal colonies

1. Pick ~20 colonies per construct. For picking, have a round-bottom 96 well plate with 75uL accutase (trypsin is harsher but will work as well and is cheaper) in each of ~30 wells. Rinse each 10cm dish right before picking with PBS and add ~5mL PBS to do the picking. Pick each colony with the tip of a 10uL pipette (using tips with filter) and put each colony in an individual well with accutase. Picking is easiest using 4X magnification. Remember to put the lid back on the dish quickly to avoid contamination. Do the entire picking in under 20 minutes so the cells in the 10cm dish won’t die and the cells in the accutase won’t spend that much time being dissociated. Look under the microscope in the 96 well plate to make sure the colonies were transferred.
2. Put the accutase 96 well plate with the colonies in the incubator for 2-3 minutes.

3. Gently triturate each well and move each colony in a 12 or 24 well plate with normal media growth media and let grow for a week or until they look healthy and expanded without having overgrown.

4. Split each colony 2/3 times. They should have expanded nicely.
5. Harvest and freeze half from each colony to store at -80C. Use the other half immediately for gDNA extraction.

7. PCR confirmation of genotype

1. Extract gDNA using QuickExtract DNA Extraction solution (Epicentre).
2. Do a PCR using primers that flank the targeted region. We used CGTGTGCATCCACGTATGA and AGGTGTGACTGAAGGAACC
3. At this step you can either sequence the PCR and identify the colonies with a single sequence that exhibits the desired modification (we did this, as we were after a double stranded knockout) or use the following step.

4. Ligate the PCR product into a vector of choice (I used pUC), transform and pick 4-6 colonies. Miniprep and sequence colonies. You should see the sequence of the 2 alleles and identify if the correct modification was done.

Once the colonies with the desired modification are identified, they can be thawed and cultured as before.

Category