Measurement of mtDNA copy number

To quantify mtDNA copy number, total DNA was isolated from eggs using QIAamp DNA Micro Kit (Qiagen). The mtDNA copy number was measured using q-PCR. Set the ratio of mtDNA/nuDNA in the wild-type as 1 (relative mtDNA amount). The ratio from other genetic manipulations will be comparied with that of wild-type.

Primers were targeted to the mtDNA-encoded cytochrome c oxidase subunit I (CoI) and the nuclear-encoded Histone 4 (His4) genes:

CoI: forward, 5′-ATTGGAGTTAATTTAACATTTTTTCCTCA-3′;

reverse, 5′-AGTTGATACAATATTTCATGTTGTGTAAG-3′;

His4: forward, 5′-TCCAAGGTATCACGAAGCC-3′; reverse, 5′-AACCTTCAGAACGCCAC-3′

Quantification of heteroplasmy

The genomic DNA from female flies and eggs was extracted. A 4-kb fragment spanning the XhoI site on mtDNA was amplified by PCR with primers shown below. The PCR products were gel-purified using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific), and digested with 20 units of XhoI (NEB) at 37°C overnight. The digested DNA (500 ng) was analyzed on an Agilent 2100 Bioanalyzer using DNA 7500 kit (Agilent). The proportion of mt:CoIT300I DNA was calculated by normalizing the amount of undigested 4-kb band (mt:CoIT300I) to the sum of undigested 4-kb band (mt:CoIT300I) and two XhoI-digested bands of 1.6 kb and 2.4 kb (mt:wt).

mt:CoI, Xho1 site genotyping F: TGGAGCTATTGGAGGACTAAATCA

mt:CoI, Xho1 site genotyping R: GCTCCTGTTAATGGTCATGGACT