Measurement of mtDNA copy number and quantification of heteroplasmy

Measurement of mtDNA copy number

To quantify mtDNA copy number, total DNA was isolated from eggs using QIAamp DNA Micro Kit (Qiagen). The mtDNA copy number was measured using q-PCR. Set the ratio of mtDNA/nuDNA in the wild-type as 1 (relative mtDNA amount). The ratio from other genetic manipulations will be comparied with that of wild-type.

Primers were targeted to the mtDNA-encoded cytochrome c oxidase subunit I (CoI) and the nuclear-encoded Histone 4 (His4) genes:

CoI: forward, 5′-ATTGGAGTTAATTTAACATTTTTTCCTCA-3′; 

reverse, 5′-AGTTGATACAATATTTCATGTTGTGTAAG-3′;  

His4: forward, 5′-TCCAAGGTATCACGAAGCC-3′; reverse, 5′-AACCTTCAGAACGCCAC-3′

Quantification of heteroplasmy

The genomic DNA from female flies and eggs was extracted. A 4-kb fragment spanning the XhoI site on mtDNA was amplified by PCR with primers shown below. The PCR products were gel-purified using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific), and digested with 20 units of XhoI (NEB) at 37°C overnight. The digested DNA (500 ng) was analyzed on an Agilent 2100 Bioanalyzer using DNA 7500 kit (Agilent). The proportion of mt:CoIT300I DNA was calculated by normalizing the amount of undigested 4-kb band (mt:CoIT300I) to the sum of undigested 4-kb band (mt:CoIT300I) and two XhoI-digested bands of 1.6 kb and 2.4 kb (mt:wt).

mt:CoI, Xho1 site genotyping F: TGGAGCTATTGGAGGACTAAATCA

mt:CoI, Xho1 site genotyping R: GCTCCTGTTAATGGTCATGGACT

Category