Improve Research Reproducibility A Bio-protocol resource
bpdetail_icon_lock
Preprint

Genomic analysis

XL Xinyu Ling
TL Tao Liu

Last updated date: Jun 22, 2020 Views: 1014 Forks: 0

original An abbreviated version of this protocol was published in Science Advances
Improving the efficiency of precise genome editing with site-specific Cas9-oligonucleotide conjugates
download pdf Download PDF
ask Ask a question
cite How to cite
nfavorite Favorite

Our gRNA targeting GAPDH sequence：CCTCCAAGGAGTAAGACCCC（PAM:AAG）

Copyright: Content may be subjected to copyright.
How to cite：
Readers should cite both the Bio-protocol preprint and the original research article where this protocol was used:
  1. Ling, X and Liu, T(2020). Genomic analysis. Bio-protocol Preprint. bio-protocol.org/prep345.
  2. Ling, X., Xie, B., Gao, X., Chang, L., Zheng, W., Chen, H., Huang, Y., Tan, L., Li, M. and Liu, T.(2020). Improving the efficiency of precise genome editing with site-specific Cas9-oligonucleotide conjugates . Science Advances 6(15). DOI: 10.1126/sciadv.aaz0051

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A
This protocol preprint was submitted via the "Request a Protocol" track.