Single-Cell TCR Sequencing

Preparation of the TCR γ/δ library

*Adapted from Mimitou et al, 2019 Nature Methods

•R1_hTRDC primer: (for Human γ/δ mix 1)

5’AGCTTGACAGCATTGTACTTCC

•R1_hTRGC primer: (for Human γ/δ mix 1)

5’TGTGTCGTTAGTCTTCATGGTGTTCC

•R2_hTRDC primer: (for Human γ/δ mix 2)

5’TCCTTCACCAGACAAGCGAC

•R2_hTRGC primer: (for Human γ/δ mix 2)

5’GATCCCAGAATCGTGTTGCTC

The TCR γ/δ library is prepared by following the 10x Genomics protocol for generating TCR α/β libraries in Chapter 5 of the 10x protocol, but substituting primers as detailed below:

PCR1: Human γ/δ mix 1 (R1_hTRDC + R1_hTRGC) instead of T cell 1

PCR2: Human γ/δ mix 2 (R2_hTRDC + R2_hTRGC) instead of T cell 2

PCR1: 2 µl full length cDNA

50 µl 2x KAPA Hifi Master mix

5 µl cDNA additive

2 µl 20 µM SI-PCR primer

2 µl 20 µM human γ/δ mix 1

Water to 100 µl

PCR2: 35 µl bead elution

50 µl 2x KAPA Hifi Master mix

5 µl cDNA additive

2 µl 20 µM SI-PCR or P5 primer

2 µl 20 µM human γ/δ mix 2

Water to 100 µl

Cleanups and PCR conditions are identical to the 10x protocol, with the exception that γ/δ libraries often require

extra cycles of amplification (~12) due to the comparative rarity of γ/δ T cells compared to α/β T cells in most cell

populations.

TCR γ/δ enriched libraries are further processed according to the 10x Genomics Single Cell V(D)J protocol.