Advanced Search
Last updated date: Nov 4, 2023 Views: 1978 Forks: 0
This protocol is revised according to the previous article (Xiao et al, Angew Chem Int Ed Engl. 2018) 1.
10×CutSmart buffer (NEB, B6004V)
dTTP (ThermoFisher, R0171)
RNAse-Free H2O (ThermoFisher, AM9937)
Bst 2.0 DNA polymerase (NEB, M0537S)
SplintR ligase (NEB, M0375S)
ATP (NEB, P0756S)
1.1 The Up primer or Down primers of Annealing primer were designed as Figure 1 from Xiao et al, Angew Chem Int Ed Engl. 2018 1.
Template sequence for m6A_modified Base 47 with yellow shadow from Xia et al, EMBO Rep, 2021 2:
attgcaccttgccggccacctttgctatctttgctgaagatgatggAcccaaactcgacttctgaagatgtaaaatttacacctgacccataccaggtgccttttgtacaagcttttgaccaagctaccagagtctatcaggacctgggagggccatcgcaagctcctttgccttgtgtgctgtggccggtgctgccagagcctctgccacaaggccagctaactgcctatcatgtttcaaccgctccgactgggtcgtggttttctgcccctcagcctgctcctgagaatgcttatcaagcttatgcagcacctcagctgttcccagtctccgacataacccagaatcaacagactaaccaagccgggggagaagcacctcaacctggagacaattctactgttcaaacagcagcagcagtggtgtttgcttgccccggggctaaccaaggacaacagctagcagacattggtgttccacagcctgcaccagtggctgccccggcacgacgcacacggaaaccacaacagccagaatcg
1.2 The Up primer or Down primers were designed with 20-21 bp PCR adapter (shown in lower cases) and 20-30 bp annealing oligo (shown in upper cases).
The Annealing primer for Base 47 is designed as bellow:
The Up primer: tagccagtaccgtagtgcgtgTTACATCTTCAGAAGTCGAGTTTGGG
The Down primer: 5phos/CCATCATCTTCAGCAAAGATAGCAAAGcagaggctgagtcgctgcat
1.3 The SELTCT qPCR primer is designed according to the PCR adapter.
qPCRF primer: ATGCAGCGACTCAGCCTCTG
qPCRR primer: TAGCCAGTACCGTAGTGCGTG
2.1 Prepare Annealing mixture:
3ug Total RNA
40 nM Up Primer
40 nM Down Primer
5 μM dTTP
10×CutSmart buffer (2ul)
RNAse-Free H2O
Total to 17 ul
2.2 The RNA and primers were annealed by incubating mixture at a temperature gradient:
90°C for 1min,
80°C for 1min,
70°C for 1min,
60°C for 1min,
50°C for 1min,
40°C for 6min,
4°C, hold.
2.3 Subsequently, a 3 μl of mixture containing 0.01 U Bst 2.0 DNA polymerase (NEB), 0.5 U SplintR ligase (NEB) and 10 nmol ATP (NEB) was added in the Annealing mixture to the final volume 20 μl of Final reaction mixture.
2.4 The Final reaction mixture is incubated at:
40°C for 20 min,
80°C for 20 min,
4°C, hold.
3.1 Prepare qPCR mixture:
2× PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) (10 ul),
200 nM qPCRF primer,
200 nM qPCRR primer,
2μl of the Final reaction mixture
ddH2O
Total to 20 ul
3.2 qPCR was run in Applied Biosystems ViiA™ 7 Real-Time PCR System (Applied Biosystems, USA) or StepOnePlus™ Real-Time PCR System (Applied Biosystems).
qPCR is run at the following condition:
95°C, 5min;
(95°C, 10s; 60°C, 35s)×40 cycles;
95°C, 15s;
60°C, 1min;
95°C, 15s (collect fluorescence at a ramping rate of 0.05°C/s);
4°C, hold.
3.3 The relative m6A level is determined by calculating the 2-ΔCt of the targeted m6A base relative to the control A base.
1. Xiao Y, Wang Y, Tang Q, Wei L, Zhang X, Jia G. An Elongation- and Ligation-Based qPCR Amplification Method for the Radiolabeling-Free Detection of Locus-Specific N(6) -Methyladenosine Modification. Angew Chem Int Ed Engl. Dec 3 2018;57(49):15995-16000. doi:10.1002/anie.201807942
2. Xia TL, Li X, Wang X, et al. N(6)-methyladenosine-binding protein YTHDF1 suppresses EBV replication and promotes EBV RNA decay. EMBO Rep. Apr 7 2021;22(4):e50128. doi:10.15252/embr.202050128
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link