Advanced Search
Last updated date: Mar 13, 2020 Views: 1003 Forks: 0
CRISPR design
GuideRNAs specific to NPM1 or COIL, respectively, close to the site of the desired position for insertion of the NeonGreen tag were selected based on low off-target and good on-target activity using http://crispor.tefor.net. The guideRNAs were ordered as crRNA from Integrated DNA Technologies (IDT) or as sgRNA from Synthego. An in vivo guide test was performed to examine the efficiency of the different guides. Efficiencies were calculated by Fluorescent PCR and capillary electrophoresis on ABI-Sequencer 3730 XL (Thermo Fischer Scientific) .
guide RNA | sequence | Off-target/specificity score* | in vivo efficiency |
NPM1_sgRNA-3 | TCCAGGCTATTCAAGATCTC | 87% | 30-45% |
NPM1_crRNA-20 | GCCAGAGATCTTGAATAGCC | 56% | 35-45% |
* according to Doench et al., 2014
Repair constructs were designed so that a 2xGS-linker (Marks and Bradbury 2004) followed by the mNeonGreen were flanked by 500 bp homology arms up- and downstream from the STOP codon of the respective gene. The repair constructs were synthesised and subcloned into pUCIDT(AmpR) backbone by IDT.
HCT cell transfection
HCT116 cells were transfected with Cas9 RNP complexes and repair constructs using Neon electroporation kit and device (Invitrogen) as previously described (Spiegel et al., 2019).
Briefly, in order to prepare crRNA-tracrRNA duplexes, RNA oligos were mixed in equimolar amounts:
Component | Amount [μl] | Final Concentration |
crRNA [100 μM] | 2 | 40 µM |
tracrRNA [100 μM] | 2 | 40 µM |
Nuclease-free TE buffer | 1 | |
Total volume | 5 |
Mixes were incubated for 5 minutes at 95˚C and cooled down to room temperature at the bench.
To form Cas9 RNP complexes, crRNA-tracrRNA duplexes or sgRNAs were combined with HF-Cas9:
Component | Amount [μl] |
crRNA-tracrRNA or sgRNA [40 μM] | 0.5 (20 pmol) |
HF-Cas9 Nuclease [20 μM] (IDT cat. no. 1081060) | 0.9 (18 pmol) |
Total volume | 1.4 |
Mixes were incubated 20 minutes at room temperature.
The electroporation mix was prepared by combining Cas9 RNP complexes, repair plasmids an cell suspension:
Component | Amount [μl] | NPM1 |
Cas9 RNP complex | 1.4 (20 pmol) | sg3-Cas9 RNP complex |
repair plasmid [500 ng/μl] | 1 (500 ng) | NPM1-HA_2xGS_mNG |
Cell suspension | 9 (100,000 cells) | |
Total volume | 11.4 |
10 ul of the electroporation mixture were used for electroporation. Electroporation settings were: 1530 V, 20 ms puls width, 1 pulse.
Selection and genotyping of cell clones
72 h after electroporation cells were harvested and single-cell sorted into 96-well plates by green fluorescence using FACS technology. (Note, only cells from electroporation mixes containing sgRNA and not crRNA-tracrRNA duplexes were used for generating single cell clones). Single cells were incubated for 6-7 days. Growing clones were analysed by microscopy and selected by bright and low-variable fluorescence. Selected clones were chosen for genotyping. A clone showing integration in both alleles with selected and used for the experiments.
Oligo used for genotyping:
NPM1 | 5' flanking | fwd | TAGCTGGGCCTCCTGTAGT |
rev | TTGCCTGTGGTATAGGACCA | ||
3' flanking | fwd | TATCTGCCCTACCCTGACG | |
rev | GCAAGTGAGGCTAGAATAGG | ||
spanning | fwd | TAGCTGGGCCTCCTGTAGT | |
rev | GCAAGTGAGGCTAGAATAGG |
Category
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link