Improve Research Reproducibility A Bio-protocol resource
bpdetail_icon_lock
Preprint

Generation of pembrolizumab scFv

ZD Zachary Davis
JM Jeffrey S. Miller

Last updated date: Aug 16, 2023 Views: 9 Forks: 0

original An abbreviated version of this protocol was published in Blood Advances in Feb, 2021
Low-density PD-1 expression on resting human natural killer cells is functional and upregulated after transplantation
download pdf Download PDF
ask Ask a question
cite How to cite
nfavorite Favorite

The nucleotide sequence for the variable heavy and variable light chain are as follows:

 

VH

CAGGTGCAGCTGGTGCAGAGCGGCGTGGAGGTGAAGAAGCCCGGCGCCAGCGTGAAGGTGAGCTGCAAGGCCAGCGGCTACACCTTCACCAACTACTACATGTACTGGGTGAGGCAGGCCCCCGGCCAGGGCCTGGAGTGGATGGGCGGCATCAACCCCAGCAACGGCGGCACCAACTTCAACGAGAAGTTCAAGAACAGGGTGACCCTGACCACCGACAGCAGCACCACCACCGCCTACATGGAGCTGAAGAGCCTGCAGTTCGACGACACCGCCGTGTACTACTGCGCCAGGAGGGACTACAGGTTCGACATGGGCTTCGACTACTGGGGCCAGGGCACCACCGTGACCGTGAGCAGC

 

VK

GAGATCGTGCTGACCCAGAGCCCCGCCACCCTGAGCCTGAGCCCCGGCGAGAGGGCCACCCTGAGCTGCAGGGCCAGCAAGGGCGTGAGCACCAGCGGCTACAGCTACCTGCACTGGTACCAGCAGAAGCCCGGCCAGGCCCCCAGGCTGCTGATCTACCTGGCCAGCTACCTGGAGAGCGGCGTGCCCGCCAGGTTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGACCATCAGCAGCCTGGAGCCCGAGGACTTCGCCGTGTACTACTGCCAGCACAGCAGGGACCTGCCCCTGACCTTCGGCGGCGGCACCAAGGTGGAGATCAAGAGGACCGTG

Copyright: © 2023 The Author(s); This is an open-access article under the CC BY-NC license (https://creativecommons.org/licenses/by-nc/4.0/).
How to cite：
Readers should cite both the Bio-protocol preprint and the original research article where this protocol was used:
  1. Davis, Z and Miller, J(2023). Generation of pembrolizumab scFv. Bio-protocol Preprint. bio-protocol.org/prep2389.
  2. Davis, Z., Felices, M., Lenvik, T., Badal, S., Walker, J. T., Hinderlie, P., Riley, J. L., Vallera, D. A., Blazar, B. R. and Miller, J. S.(2021). Low-density PD-1 expression on resting human natural killer cells is functional and upregulated after transplantation. Blood Advances 5(4). DOI: 10.1182/bloodadvances.2019001110

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A
This protocol preprint was submitted via the "Request a Protocol" track.