SG-PERT

SG-PERT- MODIFIED

(from Pizzato et al, J Vir Methods 2009, and Vermeire et al, PLoSOne 2012)

1. Clean your bench and pipettes with RNaseZap. Use filter tips throughout.

2. Thaw all reagents on ice:

Reagents and locations:

• 2X lysis buffer: Stored in the SG-PERT -20C box in freezer.

        To prepare 2x lysis buffer stock (aliquot 300ul and store at -20°C), 

        For 10ml (good amount to pipet a precise amount of glycerol):

       1ml    1M TrisHCl pH7.4       (final 100mM)

       500ul 1M KCl                        (final  50mM)

       25ul   Triton X-100                (final 0.25%)

       4ml    Glycerol                       (final 40%)

       4.475ml    dH₂O

• Ribolock RNase inhibitor: SG-PERT -20C box in freezer.
• Quantitech SYBR Green Master mix: SG-PERT -20C box in freezer.
• Primer MS2 Fwd: SG-PERT -20C box in freezer.
• Primer MS2 Rev: SG-PERT -20C box in freezer.
• MS2 RNA template: -80. These are aliquoted for single use so don’t put back.
• Riboblock RNase inhibitor: SG-PERT -20C box in freezer.
• RT standards: -80. These are aliquoted for single use so don’t put back.
• SG-PERT WATER (kept at room temp, only open in PCR hood to aliquot.)

3. Add Riboblock RNase Inhibitor to the 2x lysis buffer. Dilute the Riboblock 1:50 into 2X buffer (it will 0.4U/ul final concentration reaction). You will need 5ul of 2X lysis buffer per sample.

4. Prepare the virus dilutions. Use a fresh aliquot of virus (ie. not freeze-thawed). Dilute the virus in PBS (tissue culture grade). This must be done in the virus room in a hood. Prepare 2 dilutions to assay per virus. For concentrated virus preps, use dilutions around 10^-4 and 10^-5.  When making dilutions pipette at least 2ul of the virus stock for improved accuracy. 

5. Lyse the virus. Mix 5ul of the virus dilution with 5ul of the 2X Lysis buffer (containing Riboblock). Incubate for 10 mins at room temp. 

6. Inactivate the lysis buffer. Add 90uL of SG-PERT water. Keep on ice from now on for RT stability. 

The rest of the protocol can now be done at the bench.

7.  Prepare the mastermix. Make enough (plus 2 wells extra) to run each sample and standard in technical duplicates, plus a water control (also in duplicate). 

Per well:

8.  Aliquot 15uL of mastermix per well. Put the plate on ice or on the cold block to do this. The cold block is kept in -20C freezer. It must be stored upside down otherwise water freezes in the bottom of the wells and the plate won’t fit properly so temperature will be uneven. The first step of this reaction is an RT step, which can occur at temperatures around 25C (although not optimal) so keeping the reagents cold so each reaction starts at the same time is important.

9. Add 10uL of the SG-PERT water to the control wells. Mix thoroughly (5-10x).

10. Add 10uL of virus lysate to the well. Mix thoroughly (5-10x).

11. Prepare the standard dilution series.

The working stock (‘W’) is at 1x10¹⁰ pU/uL. Prepare a 10-fold dilution series from 1x10¹⁰pU/ul to 1x10² pU/uL using SG-PERT water.

The working stock comes as a 5uL aliquot (for single use- don’t freeze-thaw) so add 45uL of SG-PERT H20 for your first dilution.

Then do 1:10 dilutions (ie. 10+90ul- don’t pipette less than 2ul for improved accuracy) all the way down. 

12. Add 10uL of the standards from 1x10⁸pU/ul to 1x10²pU/ul to each well. This will give you a total of 1x10⁹ pU per well to 1x10³ pU per well for the standard curve (these are the values to enter for the standard curve). Mix thoroughly (5-10x).

13.  Seal the plate with the optically clear seal.

14. Centrifuge the plate (2min at 1200rpm).

15. Program and load the qPCR machine and start the reaction:

On Applied Biosystems 7500 Fast

- Fluorescence acquisition is done by the machine at the end of the elongation phase.

- Melting curve is done according to the machine default settings.

- Total running time is around 2h 20minutes.

16. On the machine check the standard curve: 

• R²: should be close to 1
• Slope should be near -3.3.
• Efficiency should be near to 100% (within range from 90-130%)
• All sample points should fall within standard curve range and serial dilutions of the same prep should dilute out well (ie. vary by the same number of Cts as the slope value for the standard curve as if using a 10 fold dilution).
• The Ct of the H20 control should be >30 or at least 6 Ct values from the lowest standard.
• Check the amplification curves or Ct/quantity values to see that the technical duplicates have both worked and are near-identical.

17. Calculate the RT activity per uL of prep. 

Step by step calculation: 

→ pU value for each well  = activity from 10uL of diluted lysate 

→ * 10 = pU from 5uL of virus prep 

→  /5 = per uL of virus prep 

→ * dilution factor. 

Calculate for the 2 dilution factors and average the two values. 

Reagents and providers

• Quantitect SYBR Green PCR kit – QIAGEN Ref. 204143.
• Ribolock RNase inhibitor – Fermentas Ref. EO0381. (40U/ul. We use it at 0.4U/ul in lysis although Fermentas recommends 1U/ul; in the qPCR reaction 10X less to avoid inhibitory effects)
• MS2 RNA – Roche Ref. 10165948001. (Original stock should be 0.8µg/µl, i.e. 0.7 pmoles/µl. Aliquot and store at -80°C).
• Primer 1 fw: TCCTGCTCAACTTCCTGTCGAG
• Primer 2 rev: CACAGGTCAAACCTCCTAGGAATG (primers do not need highest purity, just desalted).
• HIV Reverse Transcriptase, Recombinant, E. coli - Millipore Ref. 382129. (Resuspended in 10mM Potassium phosphate, 1mM DTT, 20% glycerol, pH 7.4. Aliquot and store at -80°C).