RT-qPCR for detection of REST exons. Figure 9B

Sample preparation.

RNA extraction. Mouse embryonic brain tissue from E13.5 animals was quickly dissected on ice in ice-cold PBS and separated into 1.5 ml pre-chilled tubes. 1ml of Trizol was added sequentially to each tube and a hand held homozenizer with disposable blades was used to homogenize the tissue into solution. RNA was extracted using manufacture provided protocol for Trizol (Invitrogen) and treated with DNAse on beads (cat#AM1907, Ambion, Waltham, MA). Separately, at the time of tissue collection, a small piece of embryonic tail was collected for DNA extraction for the genotyping of the embryos.

Mice were genotyped fas described in methods section or here:

Rest^GTi, Rest^GT, or Rest⁺ alleles using the following primers: GTA5: 5’-tggatgttgaggtccgttgtg-3’, GTB5: 5’-ggctacggatcccttcttccc-3’and GTB1: 5’aacggcccccgacgtccctgg-3’ to reveal 480 bp product (wild type, GTB5/GTB1 amplicon) and 600 bp (mutant, GTA5/GTB1 amplicon). Cre transgene was validated using primers CreA1: 5’-tgctgtttcactggttatgcg-3’ and CreB1: 5’ ttgcccctgtttcactatcca-3’. Mouse strain Rest^fl/fl and its genotyping was described previously (Gao et al., 2011)

cDNA synthesis. Extracted RNAs were quantified and reverse transcription reactions were performed using 1 ug of total RNA with Superscript III (Invitrogen) according to manufacture provided protocol. 20ul cDNA reactions were diluted 1:5 for the analyses of the REST mRNA and 1:50 for the analyses of 18S RNA levels. An additional cDNA reaction using 2ug of RNA from control sample was synthesized and diluted 1:3 for the setting of the standard curve.

qPCR. qPCR was performed in Applied Biosystems PRISM 7900HT Fast Real Time PCR system equipped with QuantStudio 6.0 software package. 2X SYBR green PCR master mix (Applied Biosystems, Waltham, MA) was used for the PCR and default cycling conditions were used for all samples. Briefly, for each PCR reaction, 1.5 ul of diluted cDNA was mixed with 7.5 ul of 2x qPCR Master Mix, 1 uL of primer mix (10uM each) and ddH2O was added to the total volume of 15 uL. Samples were aliquoted as triplicates into the 96 well plate. For the standard curve, six 1:5 serial dilutions were prepared from control cDNA reaction and set up in duplicates. Cycling was carried out for 40 cycles using a default protocol set up on qPCR thermocycler. Melting curves were analyzed for the presence of a single peak post PCR reaction.

Analyses. The relative abundance of cDNAs for corresponding REST exons and 18S control were determined using QuantStudio 6.0 and the amounts of cDNA for REST exons were normalized using 18S from standard curve values. Fold changes were determined by additional normalization to the control sample values and data plotted using Prizm (Graphpad) software package.

Primers sequences. Primer sequences are indicated in Supplementary file 3 and here.

Primer sequences used in the study

Primer name	5’-3’
qRT-PCR
qRestA3 (exon 1-2)	gcgcacagttcagaggagt
qRestB3 (exon 1-2)	tgttggcactgttgttgaaga
qRestA4 (exon2-3)	caagtgcaactacttctcagacaga
qRestB4 (exon2-3)	aaggacaaagttcacatttatacgg
qRestA5 (exon3-4)	gacacatgcggactcattca
qRestB5 (exon3-4)	gtcttgcatgtcgggtca
qRestA1 (exon4)	ggctgctctcaaggagtctg
qRestB1 (exon4)	ttctgctcagtgtccacgtc
q18SA	cggacacggacaggattgacaga
q18SB	accacccacggaatcgagaaaga