Chromatin immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP)

Original protocol published in Malyavko, A.N., Petrova, O.A., Zvereva, M.I. et al. Functional duplication of Rap1 in methylotrophic yeasts. Sci Rep 9, 7196 (2019). https://doi.org/10.1038/s41598-019-43595-8

With modifications described in Alexander N Malyavko, Olga A Petrova, Maria I Zvereva, Vladimir I Polshakov, Olga A Dontsova (2022) Telomere length regulation by Rif1 protein from Hansenula polymorpha eLife 11:e75010. https://doi.org/10.7554/eLife.75010

This protocol was adapted from the ChIP protocol described by the de Lange laboratory (https://delangelab.org/protocols)

1. Grow yeast cells in 100 ml of YPD at 37 °C to OD₆₀₀ ~0.9.
2. Add formaldehyde to a final concentration of 1%, incubate for 30 min at 25 °C. (Cell fixation)
3. Add glycine to a final concentration of 125 mM final, incubate 5 min at 25 °C. (To stop crosslinking).
4. Harvest cells by centrifugation (3000 g, 5min), wash 3x with TBS.
5. Re-suspend cells in 0.5 ml of buffer A, transfer to VK-05 tubes (Bertin Instruments).
6. Lyse cells with glass beads in a Precellys Evolution homogenizer (Bertin Instruments): 8 cycles of (20s 7200 rpm then 1 min on ice).
7. Add 0.5 ml of buffer B. Sonicate the lysates to shear chromatin (~300-500 bp median fragment size).
8. Clear the lysate by centrifugation (14000 g, 15 min).
9. Save a 7.5 mkl aliquot of the lysate (this will become the ‘1% of input’ sample).
10. Add 20 µl of Pierce anti-HA magnetic beads (Thermo Scientific) to 0.75 ml of the lysates and incubate (gentle rotation) at +4 °C for 2 hours.
11. Wash the beads:
    1. 1x with 1 ml of Buffer C (3-5 min of gentle rotation at room temperature).
    2. 1x with 1 ml of Buffer D (3-5 min of gentle rotation at room temperature).
    3. 2x with 1 ml of Buffer E (3-5 min of gentle rotation at room temperature).
    4. 1x with 1 ml of TE buffer (3-5 min of gentle rotation at room temperature).
12. Elution:
    1. add 250 μl of 0.1 M NaHCO₃, 1% SDS and incubate at 65 °C for 15 min (vigorous shaking). Collect the eluate.
    2. add 250 μl of 0.1 M NaHCO₃, 1% SDS and incubate at room temperature for 10 min (occasional shaking). Collect the eluate.
13. Combine the two eluate fractions (the ‘IP’ sample), add NaCl (to a final concentration of 0.2 M) and incubate overnight at 65 °C (to reverse cross-linking).
14. Add 500 mkl of 0.1 M NaHCO₃, 1% SDS to the ‘1% of input’ sample, add NaCl (to a final concentration of 0.2 M) and incubate overnight at 65 °C (to reverse cross-linking).
15. In the morning, add 20 μl of 1 M Tris pH 6.5, 10 μl of 0.5 M EDTA and 30 μg of RNase A and incubate at 37 °C for 30 min.
16. Add 100 μg of proteinase K and incubate at 37 °C for 1 hour.
17. Extract the DNA with phenol/chloroform, precipitate with EtOH and dissolve in 25 μl of TE buffer.
18. Real-time PCR was performed in a 15 μl mixture containing 0.45 μl of DNA (either ‘IP’ or ‘1% of input’ sample), 1x Taq KCl buffer, 2.5 mM MgCl₂, 0.6 μM primers, 0.2 mM dNTPs, 0.4x SYBR Green and 0.9 U of Taq polymerase (Thermo Fisher Scientific).
19. Primers:
    1. TELf                GCTAGGGAGGTGTGGGTAGTGG
    2. TELr                CGCCTGCCCCTACATTACTTTC
    3. ALA1f            GGGTTCCACCACAGAACTCAAC
    4. ALA1r             TTCGGAGAGACCTACCCAGACC

Buffers:

TBS:  50 mM Tris, pH 7.6; 150 mM NaCl

Buffer A: 50 mM HEPES pH 7.5, 140 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 0.01% sodium deoxycholate and 1x Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific)

Buffer B: 50 mM HEPES pH 7.5, 140 mM NaCl, 1 mM EDTA, 1.9% Triton X-100, 0.19% sodium deoxycholate and Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific)

Buffer C: 50 mM HEPES pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate

Buffer D: 50 mM HEPES pH 7.5, 0.5 M NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate

Buffer E: 10 mM Tris pH 8, 1 mM EDTA, 0.25 M LiCl, 0.5% NP-40, 0.5% sodium deoxycholate

TE buffer: 10 mM Tris pH 8, 1 mM EDTA