Advanced Search
Last updated date: Dec 24, 2019 Views: 1662 Forks: 0
This is a protocol for 5’ and 3’ RACE using the Takara SMARTer 5’/3’ RACE kit. You can use any method of choice for RNA extraction, however, a protocol for RNA extraction with Invitrogen’s Trizol is given here. It is recommended to use the pRACE cloning system that comes with the Takara SMARTER RACE kit, but an alternative cloning strategy using Invitrogen’s Topo II vector is described here.
Part i: Primer Design
Design primers, checking parameters with Integrated DNA Technology (IDT) oligo analyzer tool. Primer Tm should be above 60°C. If absolutely necessary, primer Tm can go down to 57°C. If planning to use the pRACE vector, add Takara proprietary sequence (GATTACGCCAAGCTT) to the 5’ end of each forward and reverse primer. Do not take into account the base pairs of the Takara proprietary sequence when calculating the primer’s annealing temperature. If you plan to do both 3’ and 5’ RACE, make sure that the reverse primer (used in 5’ RACE) is downstream of the forward primer (used in 3’ RACE).
Part I: RNA Extraction
Homogenize tissue in 200 uL of Trizol (Invitrogen).
Add 800 uL of Trizol.
Incubate for 5 minutes at room temperature.
Add 200 uL chloroform. Vortex for 10 seconds.
Incubate at room temp for 3 minutes.
Centrifuge for 15 minutes at 4°C.
Remove aqueous phase and place in clean 1.5 mL tube. Add 500 uL isopropanol to aqueous phase.
Incubate in -20°C for 30 minutes. Can leave up to 2 days.
Centrifuge for 15 minutes at 4°C.
Pour off supernatant.
Add 1 mL 75% ethanol in DEPC-H2O.
Flick tube to dislodge pellet and invert several time.
Centrifuge for 10 minutes at 4°C.
Pour off supernatant. Spin down tube to collect the rest of the liquid. Remove remaining liquid with 10 uL pipette tip.
Let pellet air dry for 2-5 minutes.
Resuspend in 13-15 uL DEPC H2O. If solution is very viscous (highly concentrated) add more water. Nano drop.
Part II: Make RACE library
Using Takara 5’/3’ SMARTer RACE kit, add 500 – 1000 ng RNA as input to both the 5’ and 3’ RACE libraries. Prepare RACE library as specified in protocol thus:
Make the buffer master mix with 1x quantities as follows:
4 uL 5x first-strand buffer
0.5 uL DTT
1 uL dNTPs
Set aside.
For each 5’ RACE library, combine
500 – 1000 ng total RNA
1 uL 5’-CDS Primer A
water to 11 uL
For each 3’ RACE library, combine
500 – 1000 ng total RNA
1 uL 3’-CDS Primer A
water to 12 uL
Mix well and spin down RACE libraries. Incubate in a thermocycler at 72°C for 3 minutes and then 42°C for 2 minutes.
Add 1 uL of the SMARTer IIA oligonucleotide to the each of the 5’ RACE libraries only.
To the buffer master mix, add 0.5 uL RNAse inhibitor and 2 uL SMARTScribe reverse transcriptase per reaction. Mix the buffer/enzyme master mix well with a pipette and spin down.
Add 8 uL of the buffer/enzyme master mix to the RACE libraries. Mix well.
Incubate in a thermocycler at 42°C for 90 minutes, 70°C for 10 minutes.
Add 30 uL Tricine-EDTA buffer to RACE libraries. Divide final volume (50 uL) into two aliquots – one to store in the -20°C, to use regularly, and a second aliquot to store in the -80°C, for when the first aliquot runs out.
Part III: RACE PCR
Using either Takara SeqAmp polymerase Takara Advantage 2 Polymerase.
For SeqAmp polymerase, use the following recipe:
25 uL SeqAmp Buffer
15.5 uL water
5 uL Universal Primer Mix (UPM)
1 uL gene specific primer
2.5 uL RACE library cDNA
1 uL polymerase
For SeqAmp polymerase, one can start with the following cycling parameters:
36 cycles of:
95°C for 30 seconds
gene specific Tm for 30 seconds (not lower than 57°C)
72°C for 2.5 minutes
72°C for 5 minutes
If the above cycling conditions yield too many bands, the cycling conditions below should be used:
5 cycles of:
95°C for 30 seconds
72°C for 1 – 2 minutes
5 cycles of
95°C for 30 seconds
68°C for 1 – 2 minutes
35 cycles of
95°C for 30 seconds
66°C for 30 seconds
72°C for 1 – 2 minutes
For Clontech Advantage 2 Polymerase, use the following recipe:
5 uL buffer
36 uL water
1 uL dNTP
5 uL Universal Primer Mix (UPM)
1 uL gene specific primer
1 uL polymerase
2.5 uL RACE library cDNA
For Clontech Advantage 2 Polymerase, use the following cycling parameters
95°C for 30 seconds
36 cycles of
95°C for 30 seconds
gene specific Tm for 30 seconds (not lower than 57 °C)
72°C for 2.5 minutes
72°C for 5 minutes
Part IV: RACE PCR post processing
Pour a 1 percent agarose gel with wells large enough to hold 40-50 uL of PCR product. Load 40 uL of product from each reaction and run out the gel. Keep the remaining 10 uL of PCR product, as it might be needed for nested PCR. If the gel shows clear bands cut each out and ligate each band separately into a vector, as detailed below. If you have non-specific banding, or a smear, on your gel, proceed to nested PCR.
Nested PCR
Take 5 uL of the original PCR product (that you did not run out on the gel) and dilute into 245 uL of Tricine-EDTA from the Takara kit. Use this template in the following PCR. (The example below is given with SeqAmp polymerase. You can modify the protocol to be used with Advantage 2 polymerase. Keep in mind that if you use SeqAmp polymerase and you do not use the pRACE vector system, you will have to add A-overhangs to your PCR product before ligation.)
25 uL SeqAmp Buffer
21 uL water
1 uL gene specific primer
1 uL UPM
1 uL template (diluted as described above from the first round of PCR)
1 uL polymerase
Use the following cycling parameters for the nested PCR:
25 cycles of:
95°C for 30 seconds
65°C for 30 seconds
72°C for 2 minutes
Run 40 uL of this PCR out on a gel, cut the bands out, and proceed to the ligation step.
Ligation
Perform gel extraction either using the nucleo-spin kit included in the Takara SMARTer RACE kit, or perform the gel extraction using Qiagen’s gel extraction kit (product 28704). Follow instructions for each kit as written in their respective manuals. In the final step of the gel extraction protocol, elute DNA product in 13 uL of water preheated to 50°C. Let heated water sit for at least 2 minutes on column filter before the final spin down.
If you have added the Clontech proprietary tag to the 5’ end of your gene specific primer, proceed to ligation using the In-Fusion kit that comes with the Takara RACE kit.
Recipe for the In-Fusion Ligation:
1 uL linearized pRACE vector
7 uL gel purified RACE product
2 uL in-fusion HD master mix
Incubate at 50°C for 15 minutes, and then chill on ice for 5 minutes. If continuing to clone the product, proceed immediately. If not, store ligation product at -20°C for up to 3 weeks.
If you have not added the Clontech proprietary tag to the 5’ end of your gene specific primer, clone into the Invitrogen PCR II Topo vector (product K465001). The ligation protocol will depend on whether you used SeqAmp polymerase or Advantage polymerase. If you used Advantage polymerase, you can proceed to ligate the PCR product into the PCR II Topo vector using the following protocol. (*Note – you must proceed with no stopping from the PCR to the the gel extraction to the ligation. Stopping after the PCR or after the gel extraction will result in the A-overhang falling off your PCR product and will reduce the efficiency of the ligation, or will result in complete failure of the ligation.)
1 uL salt solution
4 uL PCR product
1 uL vector
Incubate for 5-30 minutes at room temperature, then if continuing to clone the product, proceed immediately. If not, store ligation product at -20°C for up to 3 weeks.
If you did not add the Clontech proprietary tag to the 5’ end of your gene specific primer AND you used SeqAmp polymerase, you will have to add A-overhangs to your gel purified PCR product. This can be done with any A-tailing polymerase. An example recipe and protocol with NEB’s Taq polymerase (product M0273S) is below.
5 uL 10x ThermoPol NEB buffer
1 uL dNTP
7 uL gel purified product
36 uL water
1 uL NEB Taq polymerase
Incubate at 72°C for 20 minutes. Then use Qiagen’s PCR purification kit to clean up the product and proceed directly to the Invitrogen Topo II ligation with the protocol above.
Part V: RACE product cloning
Set a heat block or heat bath to 42°C.
.
Warm up a plate with LB agar + ampicillin either at room temperature or at 37°C.
Remove from the -80°C an aliquot of chemically competent cells and place on ice. Keep cells cold at all times.
Add 2.5 uL of ligation mix to cells.
Incubate on ice for 30 minutes.
Heat shock at 42°C for 35 seconds.
Return cells to ice for 1-2 minutes.
Add 250 uL of Luria Broth (LB). Shake cells at 220 RPM at 37°C for 1 hour.
Centrifuge cells and LB at 7500 RPM for 30 seconds. This will collect cells at the bottom of the tube and allow you to remove excess LB before plating the bacteria.
Remove 170 uL of LB from tube. Resuspend the bacterial pellet into the remaining LB by gently pipetting up and down. The amount of bacteria you plate is dependent on the cells used. If using the Stellar competent cells which come with the Takara SMARTer RACE kit, plate half the total volume of cells and keep the rest of the cells in 1 mL of LB at 4°C. For less efficient cells, plate the entire volume.
Ensure plate is completely dry before incubating at 37°C overnight.
The next morning, place plate at 4°C until the late afternoon.
At the end of the day, resuspend 6 – 10 colonies per plate in 4 mLs of LB with ampicillin. Incubate overnight, shaking at 220 RPM and 37°C. Do not allow the colonies to grow for more than 16 hours.
Isolate plasmid from bacteria using Qiagen mini-prep kit. Follow protocol exactly as written.
Send plasmids for Sanger sequencing, using M13F and M13R primers.
Part VI: Sequence analysis
Upon receipt of the Sanger sequences, check for the following:
Your gene specific primer
If this was a 3’ RACE reaction, a poly-A tail. If you are working with an organism with a sequenced genome, make sure that the poly-A tail does not come from mis-priming of an A-rich sequence in the coding sequence of your gene of interest.
If this was a 5’ RACE reaction, look for the UPM sequence (CTAATACGACTCACTATAGGGC) at the 5’ end of the transcript.
Align all the sequences you obtained from each band to make sure they contain the same product. Note that with a RACE reaction, you can obtain multiple different products from the same band extracted from a gel.
If you obtain multiple different 3’ and 5’ RACE products from the same gene, you will have to do a PCR to amplify the entire length of each transcript. To do so, design primers specific to each 3’ and 5’ RACE product, and use all possible combinations of these primers in PCRs optimized for longer products. Use the ligation and cloning protocols above for sequencing full length RACE products.
Category
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link