NPTX2 ELISA assay

NPTX2 ELISA Assay

Reagents and Solutions

1. DTT (dithiothreitol) (ThermoFisher Scientific, Cat# R0861)

2. NEM (N-Ethylmaleimide) (Sigma, Cat# E3876)

3. Rabbit anti-NPTX2 

4. Biotin-conjugated mouse anti-NPTX2

5. BSA

6. HRP-conjugated streptavidin (BioLegend, Cat# 405210)

7. TMB high sensitivity substrate solution (BioLegend, Cat# 421501)

8. 4 M H₂SO₄

9. 1X PBS

10. 1X TBS

11. 1X TBST (TBS+0.17% Tween-20)

12. Carbonate-bicarbonate coating buffer (28.6 mM Na₂CO₃, 71.4 mM NaHCO₃, pH9.5)

Procedure

1. Preparation of His-tagged NPTX2 Standard protein   

- Full length NPTX2-myc in pRK5 vector was used as a template. The N terminal fragment encoding amino acid 1 to 201 was amplified with primers 5’ GCAAGGATCCCAAGCCCAGG ATAACCC 3’ and 5’ CATGTCGACTCATGCACTGTTGCCTCTCTC 3’, and then cloned into pQE30 vector (Qiagen) at sites of BamH1 and SalI. 

- The protein was expressed in XL1-blue host cells induced by 1 mM IPTG. 

- The expressed NPTX2 fragment was purified with Ni-NTA agarose column (Qiagen), and the protein concentration was quantified with BCA kit (ThermoFisher Scientific).

2. Preparation of 96-well ELISA plate coated with rabbit anti-NPTX2

- Dilute rabbit anti-NPTX2 in carbonate-bicarbonate coating buffer to 5-7 μg/ml and add it to the ELISA plate (100 μl per well). Leave at 4^oC for overnight.

- Wash plates with TBST, two times

- Block plates with 5% BSA in TBS (200 μl per well), leave at room temperature (RT) for one hour.

- Dry the plates.

3. Preparation of CSF sample

- Pipette 80 μl of CSF samples and add 20 μl of 80 mM DTT (in PBS) into the CSF. Leave at RT for two hours.

- Add 20 μl of 200 mM NEM (in ddH₂O) into the DTT-treated CSF. Leave on ice for 30 min. Then, dilute CSF samples with 120 μl of TBS. Now the CSF samples are ready for ELISA assay.

4. Add 100 μl/well of CSF sample or the serially diluted NPTX2 standard proteins (concentrations are 9.77, 19.53, 39.06, 78.125, 156.25, 312.5, 625 pg/ml) to the ELISA plate. Incubate at 4^oC for overnight.

5. Wash plates with TBST, five times, 300 μl/well each time.

6. Add 100 μl/well of biotin-conjugated mouse anti-NPTX2 (1:800 in TBS) and incubate at RT for one hour.

7. Wash plates with TBST, five times, 300 μl/well each time.

8. Add 100 μl/well of HRP-conjugated streptavidin (1:2000 in TBS) and incubate at RT for one hour.

9. Wash plates with TBST, five times, 300 μl/well each time.

10. Add 100 μl/well of TMB high sensitivity substrate solution and incubate at RT for 20-30 min in the dark.

11. Add 100 μl/well of 4 M H₂SO₄ to stop reaction.

12. The absorbance is measured at 450 nm. The absolute levels of NPTX2 in CSF were determined by the calculation based on standard curve.

Category