Gut microbiota analysis

From Choi, Brown, and Gong et al., 2020. Sci Transl Med. 

Bacterial translocation outside the gut was analyzed in the liver and MLN collected from 9 to 12 month old TC and B6 mice in a sterile manner. Two hundred microliters of tissue homogenate (0.1 g tissue / ml PBS) was spread onto tryptic soy agar with 5% sheep blood plates (Carolina Biological) and incubated at 37°C for 24 h under aerobic conditions. The numbers of CFUs were normalized to tissue weight. Tissues from a GF B6 mouse were collected as a negative control and colon contents from conventional mice were used as positive controls. Single colonies were inoculated into nutrient broth and incubated at 37⁰C for 24 h. Sanger sequencing of full-length 16S rDNA gene was performed with universal primers (F: AGAGTTTGATCCTGGCTCAG, R: GGTTACCTTGTTACGACTT) to identify bacterial species using NCBI Basic Local Alignment Search Tool (BLAST).

Lab Protocol

1. Remove liver and MLN from mouse using aseptic technique and weigh using an analytical scale
2. Homogenize the tissue (with sterile frosted microscope slides) with sterile PBS in the hood (1mL for every 0.1g of tissue [0.1g/mL]).
   1. Total tissue (g)/0.1g = mL sterile PBS
   2. Example: for 2g of liver, add 2/0.1 = 20mL sterile PBS
3. Add 200ul tissue homogenate to each blood agar plate using aseptic techniques. Use a plate spreader to disperse the homogenate evenly.
4. Label the bottom of each plate and incubate for 24 hours at 37C.  Be sure to place agar plates upside down in the incubator to prevent condensation from flooding the agar
5. After 24 hours, take out of the incubator and count the number of CFUs on the plate
6. Normalize to # CFUs per gram of tissue (CFUs/g)
7. Pick colonies from plates and inoculate into nutrient broth. Incubate at 37C for 24 hrs. 
8. Purify DNA from cultures
9. Perform full-length Sanger sequencing of the 16S gene
10. Use NCBI Basic Local Alignment Search Tool (BLAST) for identification.

Carolina Biological blood agar plates were replaced with Fisher Scientific Blood Agar Plates Cat #: R01201 (Carolina no longer carried the item).