Improve Research Reproducibility A Bio-protocol resource
bpdetail_icon_lock
Preprint

SFB colonization

DE Daria Esterházy
DM Daniel Mucida

Last updated date: Jun 28, 2021 Views: 825 Forks: 0

original An abbreviated version of this protocol was published in Nature in Apr, 2019
Compartmentalized gut lymph node drainage dictates adaptive immune responses
download pdf Download PDF
ask Ask a question
cite How to cite
nfavorite Favorite

1. fecal DNA extraction kit: Zymo research, Cat. No. D6010, use according to manufacturer's protocol

2. 16S primers:

SFB:

SFB736F: GACGCTGAGGCATGAGAGCAT

SFB844R: GACGGCACGGATTGTTATTCA

 

UNIVERSAL(control):

UNIF340: ACTCCTACGGGAGGCAGCAGT

UNIR514: ATTACCGCGGCTGCTGGC

 

 

 

Program for q-PCR:

95C 3’ (or 10 min if Applied Bio SYBR Green mix)

40 cycles of 10’’ at 95C and 45’’ at 62C.

 

per sample:

1 ul DNA

10 ul SYBR mix

0.4 ul primer mix at 20 nM each

8.6 ul water

 

The cycle at which SFB comes up depends on the machine. If you do not have germ free mice use a Jax mouse fecal pellet or, less ideal, antibiotics treated mouse fecal pellet as negative control. The universal 16S can be used as a reference/normalization (for non-antibiotic treated mice).

Copyright: Content may be subjected to copyright.
How to cite：
Readers should cite both the Bio-protocol preprint and the original research article where this protocol was used:
  1. Esterházy, D and Mucida, D(2021). SFB colonization. Bio-protocol Preprint. bio-protocol.org/prep1226.
  2. Esterházy, D., Canesso, M. C., Mesin, L., Muller, P. A., Castro, T. B. D., Lockhart, A., ElJalby, M., Faria, A. M. and Mucida, D.(2019). Compartmentalized gut lymph node drainage dictates adaptive immune responses. Nature 569(7754). DOI: 10.1038/s41586-019-1125-3

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A
This protocol preprint was submitted via the "Request a Protocol" track.