Reverse transfection protocol
(siRNA into MCF7/MDA-MB-231/MCF12-A cells in a 60 mm2 petri format)
For each petri dish to be transfected, prepare RNAi duplex-Lipofectamine RNAiMAX complexes in the following way:
- Prepare mastermix by diluting 20 pmol of duplex into 250 ul of transfection medium (medium containing no antibiotics or serum).
- Mix lipofectamine RNAiMAX gently and add 2 ul per 250 ul of mix.
- Resuspend and add 250 ul to each petri dish.
- Allow to incubate for 20 minutes.
- Split and dilute cells in growth medium (must contain no antibiotics) to have afinal volume of 2 ml in each petri.
- Add 1.5 ml of diluted cell suspension to each well containing the RNAi duplex- Lipofectamine RNAiMAX complexes.
- Mix gently
- Allow to incubate until cells are ready to treat (24-48 hours later).
488 nm laser and 610LP, 616/23BP emission filters.
ATG5 siRNA transfections
Cells were transfected using a reverse transcription protocol into 60 mm petri dishes. 20 pmol of ATG5 siRNA duplex (Cell Signalling, MA, USA, lSilence® Atg5 siRNA I #6345) was diluted into 250 µl of transfection medium (containing no antibiotics or serum). 2 µl of Lipofectamine™ RNAiMAX (13778075; Invitrogen™, USA) was gently mixed and added to this. 250 µl of this suspension was then added to each petri dish and allowed to incubate for 20 minutes. 100 000 MCF12A cells or 80 000 MDAMB231cells were then plated into the culture dishes containing the RNAi duplex-Lipofectamine RNAiMAX complexes to have a final volume of 2 ml and gently mixed. Cells were incubated at 37°C until ready to treat (24-48 hours later). Stealth RNAi (STEALTH RNAI NEG CTL MED GC, 12935300; Invitrogen™, USA) was used as a negative control, as suggested by the manufacturer. Cells were treated 48 hours later.
RNA extraction, cDNA synthesis and RTPCR
Total RNA was extracted and purified using the PureLink™ RNA Mini Kit (12183018A; Invitrogen™, USA) as per the manufacturer's instructions. RNaseOUT™ Recombinant Ribonuclease Inhibitor (10777019; Invitrogen™, USA) was then added to samples before they were stored at -40°C. cDNA was then synthesised using the SuperScript® III First-Strand Synthesis SuperMix (18080051; Invitrogen™, USA) as per the manufacturer’s instructions. Gene expression was analyzed using realtime-PCR that was performed using the 96-well cycler StepOnePlus™ Real-Time PCR System and SYBR® Green dye. Analysis was performed by the Central Analytical Facility of Stellenbosch University, DNA Sequencing Facility located in the Department of Genetics under the supervision of Dr Ruhan Slabbert. The following primers were selected and purchased through the Central Analytical Facility with the assistance of Dr Ruhan Slabbert.:
ATG5 autophagy 5-like [Homo sapiens]. PrimerBank ID 4757798a1. Amplicon size 171. Primer sequence (5' → 3'). Forward primer (TTGACGTTGGTAACTGACAAAGT), reverse primer (TGTGATGTTCCAAGGAAGAGC). Heat-shock 90kD protein-1, beta [Homo sapiens]. PrimerBank ID 2014949594a1. Amplicon size 247. Primer sequence (5' → 3'). Forward primer (TGGTGTGGTTGACTCTGAGGA), reverse primer (GGAGGTATGATAGCGCAGCA). NADH dehydrogenase (ubiquinone) 1 alpha subcomplex. PrimerBank ID 4758770a1. Amplicon size 102. Primer sequence (5' → 3'). Forward primer (GGACTGGCTACTGCGTACATC), reverse primer (GCGCCTATCTCTTTCCATCAGA). β-cytoskeletal actin [Homo sapiens]. PrimerBank ID 4501885a1. Amplicon size 250. Primer sequence (5' → 3'). Forward primer (CATGTACGTTGCTATCCAGGC), reverse primer (CTCCTTAATGTCACGCACGAT).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this
article to respond.