Improve Research Reproducibility A Bio-protocol resource
bpdetail_icon_lock
Preprint

CRISPR/Cas9 PRMT1 knockout

MM María F. Montenegro
JR José Neptuno Rodríguez-López

Last updated date: Jun 23, 2021 Views: 805 Forks: 0

original An abbreviated version of this protocol was published in Scientific Reports in Jan, 2020
PRMT1-dependent methylation of BRCA1 contributes to the epigenetic defense of breast cancer cells against ionizing radiation
download pdf Download PDF
ask Ask a question
cite How to cite
nfavorite Favorite

sc-420952: PRMT1 Plasmid CRISPR/Cas9 KO (m) is a pool of 3 different gRNA:

 

 

sc-420952 A:

  • Sense: CGGGGGCCCGCAAGGTTATT sc-420952B:
  • Sense: CACCTCCATGATGCAGTTCG sc-420952C:
  • Sense: CTCACCATGGTCTAACTTGT
Copyright: Content may be subjected to copyright.
How to cite：
Readers should cite both the Bio-protocol preprint and the original research article where this protocol was used:
  1. Montenegro, M and Rodríguez-López, J(2021). CRISPR/Cas9 PRMT1 knockout. Bio-protocol Preprint. bio-protocol.org/prep1185.
  2. Montenegro, M. F., González-Guerrero, R., Sánchez-del-Campo, L., Piñero-Madrona, A., Cabezas-Herrera, J. and Rodríguez-López, J. N.(2020). PRMT1-dependent methylation of BRCA1 contributes to the epigenetic defense of breast cancer cells against ionizing radiation. Scientific Reports 10. DOI: 10.1038/s41598-020-70289-3

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A
This protocol preprint was submitted via the "Request a Protocol" track.