×
Please leave your comments or questions
 

Testing for mycoplasma in cell culture by PCR

Author: Sandipan Dasgupta, updated date: , view: 15, Q&A: 0
Tags: PCR, Cell Culture, mycoplasma and Gel electrophoresis

Materials and Reagents

  1. Nuclease free water

  2. Go-Taq Green master mix x2 (Promega M712B)

  3. Fwd oligo:  Combine to a final concentration of 10 uM.


    CGCCTGAGTAGTACGTTCGC
    CGCCTGAGTAGTACGTACGC
    TGCCTGAGTAGTACATTCGC
    TGCCTGGGTAGTACATTCGC
    CGCCTGGGTAGTACATTCGC
    CGCCTGAGTAGTATGCTCGC


  4. Rev oligo: Combine to a final concentration of 10 uM.


    GCGGTGTGTACAAGACCCGA
    GCGGTGTGTACAAAACCCGA
    GCGGTGTGTACAAACCCCGA
  5. Negative control (e.g. medium only)

  6. Positive control (medium from infected culture)

  7. Agarose powder

  8. Running buffer (recipe)


Equipment

  1. Pipetors 20μl, 10μl

  2. Filter tips

  3. Eppendorf tubes

  4. PCR tubes 0.2ml

  5. Heating block (95°C)

  6. PCR machine

  7. Mini-centrifuge

  8. Microspin benchtop centrifuge

  9. Gel electrophoresis aparatus

  10. UV imaging (3rd floor)


Procedure

  1. Collect 100μl of cell culture media from plate into eppendorf tube.

  2. Boil samples to 95°C for 5min

  3. Centrifuge at top speed for 2min.

  4. Prepare PCR mix as follows (multiply by the number of samples):

  5. Reagentvolume
    Go-Taq Green master mix x2
    10μl 
    Fwd primer1.5μl 
    Rev primer1.5μl 
    Sample1μl 
    Water6μl 
    total:20μl 
  6. Don't forget to include negative & positive controls.

  7. Use the program Sandi-->myco1. program details: 

    95/ 5min, (95/30 secs, 50/30 secs/ 72/35 secs) X 5 cycles, (95/30 secs, 56/20 secs/ 72/30 secs) X 25 cycles, 72/1 min, 4/hold

  8. Once done, load the samples directly on gel and run for 10-15min at 300/250V.

  9. Image gel.



Comment
Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data including images for the troubleshooting.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.