tRNA charging assay

tRNA charging assay
 

Day 1: Harvest

1. Place cells in 6-well dishes on ice and wash with cold PBS.
2. Add 1 mL TRIzol on ice in fume hood, let lyse for 5 min.
3. Add 200 uL chloroform into a set of fresh prelabeled eppendorf tubes, one per sample.
4. Pipet Trizol lysates into eppendorfs containing chloroform.
5. Shake vigorously 20 sec and let sit on ice for 10 min.
6. Spin down for 15 min at 18,600g at 4°C.
7. Transfer 370 uL of the top fraction into new prelabeled tubes with prealiquotted 2 uL of GlycoBlue coprecipitant.
8. Add 1000 uL of cold 100% EtOH, invert several times to mix and incubate in -20°C overnight.

Day 2: Cleanup and reprecipitation

1. Spin down precipitated samples for 30 min at 18,600g at 4°C.
2. Remove as much supe as possible (do a quick spin-down).
   Note: do not let tubes dry for any extra time as the pellet will not dissolve.
3. Add 300 uL of room temp tRNA reprecipitation buffer.
4. Incubate at room temp (~5 min) with flicking to ensure the pellet is dissolved.
5. Add 810 uL of ice-cold EtOH, mix by inversion and precipitate in -20°C overnight.
    

Day 3: 3’-OH oxidation and cleanup 

Note: it is best to do Day 1 through Day 3 on consecutive days, because charged tRNAs are unstable even when stored in -80°C.

1. Spin down precipitated samples for 30 min at 18,600g at 4°C.
   Note: there will be flaky salt precipitate, but it is ok – try to carefully remove most of the supe without disturbing the blue bits.
2. Wash with 1 mL 80% EtOH.
3. Spin down for 10 min at 18,600g at 4°C, remove the supe.
4. Resuspend in 32 uL tRNA resuspension buffer, flick to dissolve, keep on ice.
5. Measure the RNA concentration on Nanodrop.
6. Set up oxidation and control reactions (one of each per sample) in PCR strip tubes: 
   1M Na Acetate buffer, pH = 4.5                                                                1.5 uL
   RNA sample (2 ug) diluted with tRNA resuspension buffer                   13.5 uL
   NaIO₄ (for “oxidized”) or NaCl (for “control”) from 0.2M stock         0.8 uL
   Note: prepare 0.2M stock of NaIO₄ in water and store in small aliquots in -20°C, discard after single use.
7. Incubate at room temperature for 20 min in the dark.
8. Quench by adding 2.2 uL of 2.5M glucose, incubate for 15 min at room temperature in the dark.
9. Into fresh prelabeled eppendorf tubes (one per sample), add 1.5 uL GlycoBlue + 1.3 uL 1M NaCl, keep on ice.
10. Into glucose-quenched reactions in PCR strips (step 22), add 1 uL/tube of yeast Phe tRNA (Cat. #R4018, Sigma) solution (7 ng/uL stock in water) to serve as a spike-in control.
11. Transfer the entire volume (approximately 20 uL) into eppendorfs from step 25.
12. Add 59 uL of ice-cold 100% EtOH and mix by pipetting.
13. Let precipitate in -20°C overnight.
     

Day 4: Deacylation

1. Spin down precipitated samples for 30 min at 18,600g at 4°C, remove the supe.
2. Resuspend in 100 uL of 50 mM Tris pH = 9.
3. Incubate at 37°C for 45 min.
4. Quench with 100 uL of tRNA quench buffer.
5. Add 2.7x of ice-cold 100% EtOH (540 uL), mix by inversion and precipitate in -20°C overnight.
    

Day 5: 

Sample Resuspension/Quantitation.

1. Spin down the samples for 30 min at 18,600g at 4°C, remove the supe.
2. Spin down briefly and remove the remainder of the supe with a p200 tip.
3. Resuspend in 10 uL water.
4. Measure the concentration on Nanodrop (use only 1 uL).
5. Adjust the volumes with water to bring all samples to the same concentration.
6. Store the samples at -80°C (they will be stable for several months).

Adaptor ligation:

1. Reaction set-up:
   tRNAadap                                                            0.5 uL
   10x T4 RNA ligase buffer (NEB, Cat. #M0373)     0.5 uL
   DTT (0.1 M)                                                           0.2 uL
   DMSO (100%)                                                       0.5 uL
   Water                                                                    0.16 uL
2. Distribute 2 uL of the master mix into 8 PCR tubes, add 2.5 uL of the RNA samples from (36), mix by pipetting.
3. Denature for 30 sec at 90C, then immediately put on ice for 1 min.
4. Prepare enzyme master mix, add 0.5 uL per reaction:
   RNAse inhibitor (Cat. # N2115, Promega)                           0.27 uL
   T4 RNA ligase 2, truncated KQ (NEB, Cat. #M0373)            0.3 uL
5. Incubate overnight at 18C.

RT primer annealing:

1. Add 1 uL of the 5 uM CSQ_RT primer dilution to samples from (42), mix by pipetting.
2. Incubate:
   30 sec at 90°C, 
   5 min at 65°C,
   Immediately put on ice for 1 min.

cDNA synthesis:

1. Reaction set-up:
   Water                                                                 0.8 uL
   5X SuperScript RT IV buffer                               1.6 uL
   10 mM dNTPs                                                    0.4 uL
   DTT (0.1 M)                                                         0.4 uL
   RNase inhibitor                                                   0.4 uL
   SuperScript RT IV (Cat. 18090050, Thermo)        0.4 uL
2. Combine 4 uL of the master mix with 4 uL of reactions from (44).
3. Incubate:
   30 min at 55°C,
   10 min at 80°C,
   4°C.
4. Dilute reactions with water 1:10.

qPCR:

1. Set up 10 uL qPCR reactions with:
   cDNA dilution from (48)                                                           2.5 uL
   qPCR primer pair mix (10 uM conc. of each primer)                0.2 uL
   water                                                                                         2.3 uL
   2x SYBR Green mix (Cat. #4368702, Life Technologies)            5 uL
2. On the qPCR machine software, change elongation temperature to 63°C.
3. For ddCt calculation, normalize to the yeast Phe tRNA control.

Oligo Sequences:

tRNAadap                          5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′

CSQ_RT                              GCTGCCTTGGCACCCGAGAATTCCA

ValMAC_FW                      GTTTCCGTAGTGTAGTGGTTATCACGTTCG

ValMAC_RV                       GAGAATTCCATGGTGTTTCCGCCC

LeuWAG_FW                     GGTAGYGTGGCCGAGCG

LeuWAG_RV                      GAGAATTCCATGGCAGYGGTGGG

iMetCAT_FW                     AGCAGAGTGGCGCAGCG

iMetCAT_RV                      GAGAATTCCATGGTAGCAGAGGATGGTTTCG

eMetCAT_FW                    GCCTCSTTAGCGCAGTAGGTAG

eMetCAT_RV                     GAGAATTCCATGGTGCCCCSTS

GlnCTG_FW                       GGTTCCATGGTGTAATGGTNAGCACTCTG

GlnCTG_RV                        GAGAATTCCATGGAGGTTCCACCGAGATTTG

ArgACG_FW                       GGGCCAGTGGCGCAATG

ArgACG_RV                        GAGAATTCCATGGCGAGCCAGC

yPheFW (spike-in)              GCGGAYTTAGCTCAGTTGGGAGAG

yPheRV (spike-in)              GAGAATTCCATGGTGCGAAYTCTGTGG 

Note: qPCR Primers work for both mouse and human samples.

Solutions

Note: use RNAse-free water.
 

tRNA reprecipitation buffer 

0.3M acetate buffer, pH = 4.5

10 mM EDTA

tRNA resuspension buffer 

10 mM acetate buffer pH = 4.5

1 mM EDTA

tRNA quench buffer

50 mM Na Acetate buffer (pH = 4.5)

100 mM NaCl