In vitro cellular experiments

In vitro cellular experiments

DC2.4 cells were cultured in RPMI medium supplemented with 10% FBS and penicillin-streptomycin at 37°C with 5% CO₂.
 

Isolation of bone marrow-derived dendritic cells (BMDCs) 

Prepare BMDC medium: RPMI 1640 (Gibco) supplemented with 10% FBS (Gibco), sodium pyruvate (Gibco), granulocyte-macrophage colony-stimulating factor (GM-CSF) (20 ng ml−1; BioLegend), interleukin-4 (IL-4) (10 ng ml−1; BioLegend), 2 mM l-glutamine (Gibco), 20 μM 2-mercaptoethanol (Gibco), penicillin-streptomycin (Gibco), 1×nonessential amino acids (Gibco), and 10 mM Hepes (Gibco). 

Procedure:

1. Peel out the femur and tibia of the C57BL/6J mice, remove the muscle and tissue.
2. Flush the bone marrow into RPMI 1640 (Gibco) supplemented with 1% FBS (Gibco) and penicillin-streptomycin (Gibco) using syringes.
3. Centrifuge the samples in 15 ml tubes 300g for 5 min.
4. Remove the supernatant.
5. Resuspend the cell pellet with 1 ml Red Blood Cell Lysis Buffer (Biolegend) for 1 min at room temperature.
6. Add 3ml RPMI 1640 (Gibco) supplemented with 1% FBS (Gibco) and penicillin-streptomycin (Gibco) .
7. Centrifuge the samples 300g for 5 min.
8. Remove the supernatant. Resuspend the cell pellet with 1 ml BMDC medium.
9. Count the cell number, and dilute the cells to 1 million per milliliter.
10. Plate the cells in 6 cm dishes, 5 million cells per dish.
11. The medium was half replaced two times a week. 
12. On day 7, nonadherent and loosely adherent cells were the immature BMDCs.

Cell stimulation: 

1. DC2.4 cells and BMDCs were collected.
2. Count the cell number, and dilute the cells to 1 million per milliliter.
3. Plate the cells in a 24-well plate at 1 million cells per well for 24 hours.
4. Incubated the cells with PS3D1, PS3D1@DMXAA, or the physical mixture of PS3D1 and DMXAA with indicated dosages for indicated times.
5. Then the cells were collected and the Ifnb and Cxcl10 mRNA expression levels were analyzed by qPCR.

The procedure of Isolation of RNA, q-PCR was a modified protocol¹.
 

Isolation of RNA

Total RNA was extracted using TRIzol reagent (Invitrogen).

1. After the stimulation, remove the supernatant of each well, add 0.5 ml TRIzol reagent and pipette the cell and TRIzol reagent mixture into new 1.5ml RNase-free tubes. 
2. Add 100μL of chloroform to each sample. Mix well and incubate for 3 min at room temperature.
3. Centrifuge at 10,000g for 15 min at 4°C.
4. Transfer 250μL of the aqueous phase to an RNase-free tube.
5. Add 250μL of isopropanol.
6. Mix well and incubate for 12 ~ 16 h at -20°C.
7. Centrifuge at 10,000g for 15 min at 4°C. Remove the supernatant.
8. Wash the pellet twice with 1 mL of 75% ethanol in DEPC-treated H₂O. 
9. Centrifuge at 10,000g for 10 min at 4°C.
10. Remove the supernatant.
11. Re-centrifuge the sample tubes at 10,000g for 1 min at 4°C.
12. Carefully remove the remaining supernatant.
13. Incubate for 5 min at room temperature.
14. Resuspend each pellet in 20 μL of DEPC-treated H₂O.
15. Keep samples on ice or at -20°C for long time storage.
     

Reverse transcription (RT)

Reverse transcription (RT) was carried out using a PrimeScript™ RT-PCR kit (Takara) following the manufacturer’s protocols.

1. Calculate the volume of RNA eluate (from Step 31) equivalent to 0.5 μg of RNA.
2. Add 0.5 μg of RNA to 10 μL reactions performed in 0.2 mL PCR tubes.
3. Perform reverse transcription according to the manufacturer’s instructions for the reverse transcriptase of choice.
    

q-PCR: Quantitative Real-Time PCR

Then, q-PCR was performed using a 384-well LightCycler® 480 Instrument II (Roche) with SYBR Green master mix (Vazyme). The corresponding primers were as follows:

1. Design primers:
   mIfnb       Forward primer: CAGCTCCAAGAAAGGACGAAC
                    Reverse primer: GGCAGTGTAACTCTTCTGCAT
   mcxcl10   Forward primer: GCCGTCATTTTCTGCCTCA
                   Reverse primer: CGTCCTTGCGAGAGGGATC
   mβ-actin:    Forward primer: CGTTGACATCCGTAAAGACC 
                      Reverse primer: AACAGTCCGCCTAGAAGCAC
2. Dilute cDNA (from Step 35) 1:10 with RNase- and DNase-free H2O.
3. Set up 10 μL qRT-PCR reactions using the following:
   1X SYBR Green master mix (Vazyme): 5 μL
   0.5 μM each of the forward and reverse primers: 0.5 μL
   diluted cDNA: 4.5 μL
4. Pipette reactions into a 384-well optical plate.
5. Q-PCR was performed using a 384-well LightCycler® 480 Instrument II (Roche) detection system.
6. Data analysis. The fold change of target genes was calculated using the 2^−ΔΔCt method². 

Reference：

1.   Lan CC, Tang R, Un San Leong I, Love DR. Quantitative real-time RT-PCR (qRT-PCR) of zebrafish transcripts: optimization of RNA extraction, quality control considerations, and data analysis. Cold Spring Harb Protoc 2009, pdb prot5314 (2009).

2.  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408 (2001).