Advanced Search
CRISPR constructs: pX330-CD163 and pX330-pAPN vectors for targeting pig CD163 and pig pAPN
(1) sgRNA selection. In this study, we designed two sgRNAs to target exon 7 of the porcine CD163 gene (GenBank: NC_010447) and exon 2 of the porcine pAPN gene (GenBank: NC_010449.5). The sgRNA sequences are shown in Table 1 below.
Table 1 sgRNA sequences
sgRNAs | Sequences (PAM sequences are shown in bold) |
CD163-sgRNA | GGAAACCCAGGCTGGTTGGAGGG |
pAPN-sgRNA | GCATCCTCCTCGGCGTGGCGG |
(2) pX330 linearization. The pX330 vector was used to express sgRNA and Cas9 proteins. We first linearized the pX330 empty vector (Addgene plasmid #42230), and then inserted the designed sgRNA sequence into the linearized vector. The linearization system is shown in Table 2 below.
Table 2 pX330 linearization system
Components | Amount |
pX330 plasmid | 1 μg |
BbsⅠ | 1 μL |
Buffer | 3 μL |
H2O | to 30 μL |
The ligation reaction at 37°C for 2 h.
(3) Purify and recover the linearized plasmid. The linearized plasmid was purified and recovered according to the instructions of the kit (TIANGEN, DP209).
(4) Synthesis of oligos. The sgRNA oligos of sense strand and antisense strand were synthesized according to the principles in Table 3 below.
Table 3 Oligo synthesis principles
Oligos | Sequences |
Oligos of sense strand | 5’-CACC-18-20 bp (sgRNA sequences) -3’ |
Oligos of antisense strand | 5’-AAAC-18-20 bp (reverse complement of sgRNA sequences) -3’ |
For CD163-sgRNA and pAPN-sgRNA, we synthesized a pair of oligo sequences. The sequences are shown in Table 4 below.
Table 4 Oligo synthesis for CD163-sgRNA and pAPN-sgRNA
Oligos | Sequences |
CD163-sgRNA-F | CACCGGAAACCCAGGCTGGTTGGA |
CD163-sgRNA-R | AAACTCCAACCAGCCTGGGTTTCC |
pAPN-sgRNA-F | CACCGCATCCTCCTCGGCGTGG |
pAPN-sgRNA-R | AAACCCACGCCGAGGAGGATGC |
(5) Annealing the sgRNA oligos. The annealing reaction system is shown in Table 5 below.
Table 5 Oligo annealing reaction system
Components | Amount |
Oligos of sense strand | 10 μL (10 μM) |
Oligos of antisense strand | 10 μL (10 μM) |
NEB buffer 3 | 5 μL |
H2O | 25 μL |
Total | 50 μL |
The reaction was incubated at 98°C for 10 min and cooled to room temperature naturally.
(6) Ligation of annealed oligos into BbsI-digested pX330 plasmid. The ligation reaction system is shown in Table 6 below.
Table 6 pX330 ligation reaction system
Components | Amount |
BbsI-digested pX330 plasmid | 1 μL |
annealed oligos | 4 μL |
DNA Ligation Solution I | 5 μL |
Total | 10 μL |
Incubate at 16°C for 1 h.
(7) Transformation and sequencing. The ligated plasmid was transformed into a competent E. coli strain and a single colony was picked for sequencing. The sequencing primer is as follows: 5’-GAGGGCCTATTTCCCATGATTCC-3’.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Share
Bluesky
X
Copy link