Advanced Search
Published: Aug 12, 2021 Views: 710
From Choi, Brown, and Gong et al., 2020. Sci Transl Med.
Bacterial translocation outside the gut was analyzed in the liver and MLN collected from 9 to 12 month old TC and B6 mice in a sterile manner. Two hundred microliters of tissue homogenate (0.1 g tissue / ml PBS) was spread onto tryptic soy agar with 5% sheep blood plates (Carolina Biological) and incubated at 37°C for 24 h under aerobic conditions. The numbers of CFUs were normalized to tissue weight. Tissues from a GF B6 mouse were collected as a negative control and colon contents from conventional mice were used as positive controls. Single colonies were inoculated into nutrient broth and incubated at 370C for 24 h. Sanger sequencing of full-length 16S rDNA gene was performed with universal primers (F: AGAGTTTGATCCTGGCTCAG, R: GGTTACCTTGTTACGACTT) to identify bacterial species using NCBI Basic Local Alignment Search Tool (BLAST).
Lab Protocol
Carolina Biological blood agar plates were replaced with Fisher Scientific Blood Agar Plates Cat #: R01201 (Carolina no longer carried the item).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Share
Bluesky
X
Copy link