Advanced Search
Last updated date: Mar 31, 2024 Views: 2541
TOP and BOTTOM 20 nt oligos of the target sequence
sgRNA plasmid with BbsI cloning site (e.g. pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A); pKLV-U6gRNA(BbsI)-PGKpuro2ABFP; pC016 - LwCas13a guide expression backbone with U6 promoter)
sequencing oligo LK0.1 5' (GACTATCATATGCTTACCGT)
T4 DNA ligase + buffer
T4 PNK
Buffer Tango
DTT (10mM)
ATP (10mM)
BbsI restriction enzyme
Nuclease free water
0.2 ml PCR tubes
PCR machine
Prepare 100μM stock solution (in water) of TOP and BOTTOM oligos.
Annealing - prepare the following mix in 0.2ml PCR tube:
In the PCR machine, use the following steps: 37°C 30min → 95°C 5min → cool to 25°C at a rate of 5°C/min.
Dilute annealed oligo 1:200 in water
Cloning - prepare the following mix in 0.2ml PCR tube:
Incubate, in the PCR machine, using the following steps: 37°C 5min → 21°C 5min, repeat for 6 cycles.
Transform 2-5 μl of the reaction to E. coli.
Verify correct cloning and insertion by plasmid prep from single colonies and sequencing using oligo LK0.1 5'
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA & Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8(11): 2281-2308.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Linkedin
Bluesky
X
Facebook
Copy link