Advanced Search
Last updated date: Apr 1, 2024 Views: 1006
Cas9‐sgRNA plasmid with no targeting sequence: pDD162 plasmid (Addgene: 47549)
Roller co‐injection marker: pRF4 plasmid
Cherry co‐injection marker (optional): pCFJ90 plasmid (Addgene: 19327)
Site‐directed mutagenesis: Thermo Scientific™ Phusion Site-Directed Mutagenesis Kit
DNA purification: PureLink PCR Micro kit (Invitrogen, K310050 or K310250)
DNA quantification: NanoDrop
Design the sgRNA guide sequences:
Design at least TWO high‐specific sgRNA targeting sequences for each knocking‐out experiment. An easy way is to design using the web‐based sgRNA design tool developed by
Feng Zhang’s lab:
http://crispr.mit.edu/
Submit 50 ~ 200 bp genomic DNA sequence for each analysis (submit two times if you want
make a longer‐sequence knocking‐out):
Sequence Type: other region;
Target genome: C.elegans (ce10).
Tips:
Choose the guide sequences with higher score (i.e. > 90);
Avoid the guide sequences with continuous T or with higher A‐T base pairing;
Avoid the guide sequences prone to forming hairpins.
Construct Cas9‐sgRNA plasmid:
Insert each of the desired targeting sequence into pDD162 using the site‐directed
mutagenesis kit following the manufacture’s procedures. The PCR primers should be as followings,
Forward primer (sgRNA‐specific): 5’‐N20GTTTTAGAGCTAGAAATAGCAAGT‐3’, where N20 is replaced by the desired 20‐bp targeting sequence;
Reverse primer (common for all sgRNAs): 5’‐CAAGACATCTCGCAATAGG‐3’.
Note: the NGG motif must be only present in the genomic target sequence but is not included in the sgRNA sequence.
Confirm the sgRNA plasmid by sequencing:
Sequencing primer: 5’‐GGTGTGAAATACCGCACAGA‐3’
Template plasmid for homologous recombination (HR).
Design PCR primers for constructing the HR plasmid:
Design both 5' HR arm and 3' HR arm PCR primers according to the Thermo Scientific™ Phusion Site-Directed Mutagenesis Kit.
The HR arms wih 900 ~ 1200 bp work well.
If the sgRNA target sequences are present in the HR template plasmid, design mutagenesis
primer pair to mutate either the PAM (NGG motif) or sgRNA targeting sequence by
introducing silent mutations.
Note: Verify the plasmid before worm injection by sequencing, make sure the translation frame, ATG start codon and stop codon are all correct.
Purify the plasmids:
quantify the concentration using NanoDrop.
Mix plasmids for injection:
Prepare the injection mixture as followings:
Plasmid Final concentration
HR plasmid: 50 ng/μl
sgRNA‐1: 50 ng/μl
sgRNA‐2: 50 ng/μl
pRF4: 50 ng/μl
pCFJ90 (optional): 5 ng/μl
H2O:
Total 5 μl
Worm injection:
Microinject the mixture into the gonads of young adult worms. When the F1s grow into L4 stage, pick and single the roller worms into the new OP50 plates. 50 ~150 roller worms are needed to obtain the knocking‐in worms.
Identify the F1 heterozygous knocking‐in worms by single‐worm PCR:
The single worm PCR is as the same as that used in knocking‐out experiment. Use 2 ~ 2.5 μl
worm lysate as template in a 10 μl PCR reaction, and use the KI primers for PCR amplification.
Knocking‐in worms can be identified by sequencing at this step. The 10 μl of worm lysate is
sufficient for PCR and sequencing. If worm lysate is not enough, sequencing also can be
performed using the F2 worms.
For screening the site‐directed mutation F1 worms, the 10 μl of PCR product can be directly
submit to enzyme digest, by adding 1/10 volume of 10x buffer and the desired enzyme into
the PCR product.
Identify the F2 homozygous knocking‐in worms:
For the KI‐PCR positive F1 worms, pick and single 10 ~ 20 F2 offspring worms into the new
OP50 plates, and culture until enough F3 worms hatch.
Identify the homozygous knocking‐in worm using both the KI and the WT primer pair.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link