2.10. Quantitative polymerase chain reaction

RG Rick H. van Gorp
ID Ingrid Dijkgraaf
VB Vanessa Bröker
MB Matthias Bauwens
PL Peter Leenders
DJ Danyel Jennen
MD Marc R. Dweck
JB Jan Bucerius
JB Jacco J. Briedé
JR Joanne van Ryn
VB Vincent Brandenburg
FM Felix Mottaghy
HS Henri M. H. Spronk
CR Chris P. Reutelingsperger
LS Leon J. Schurgers
ask Ask a question
Favorite

RNA extraction, complementary DNA synthesis, and quantitative polymerase chain reaction were performed as described previously. 27 The following primers were used: monocyte chemoattractant protein 1 (MCP1) forward; 5′‐CCCCAGTCACCTGCTGTTAT‐3′, MCP1 reverse; 5′‐TGGAATCCTGAACCCACTTC‐3′, interferon (IFN)‐γ forward; 5′‐CCAACGCAAAGCAATACATGA‐3′, IFN‐γ reverse; 5′‐CCTTTTTCGCTTCCCTGTTTTA‐3′, interleukin (IL)‐1ß forward; 5′‐AAACCTCTTCGAGGCACAAG‐3′, IL‐1ß reverse; 5′‐GTTTAGGGCCATCAGCTTCA‐3, tumor necrosis factor (TNF)‐α forward; 5′‐TGCACTTTGGAGTGATCGGC‐3′, TNF‐α reverse; 5′‐AGCTTGAGGGTTTGCTACAACA‐3′; and for normalization: GAPDH forward; 5′‐AACGGATTTGGTCGTATTGGGC‐3′, GAPDH reverse; 5′‐CTTGACGGTGCCATGGAATTTG‐3′.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A