RNA extraction, complementary DNA synthesis, and quantitative polymerase chain reaction were performed as described previously. 27 The following primers were used: monocyte chemoattractant protein 1 (MCP1) forward; 5′‐CCCCAGTCACCTGCTGTTAT‐3′, MCP1 reverse; 5′‐TGGAATCCTGAACCCACTTC‐3′, interferon (IFN)‐γ forward; 5′‐CCAACGCAAAGCAATACATGA‐3′, IFN‐γ reverse; 5′‐CCTTTTTCGCTTCCCTGTTTTA‐3′, interleukin (IL)‐1ß forward; 5′‐AAACCTCTTCGAGGCACAAG‐3′, IL‐1ß reverse; 5′‐GTTTAGGGCCATCAGCTTCA‐3, tumor necrosis factor (TNF)‐α forward; 5′‐TGCACTTTGGAGTGATCGGC‐3′, TNF‐α reverse; 5′‐AGCTTGAGGGTTTGCTACAACA‐3′; and for normalization: GAPDH forward; 5′‐AACGGATTTGGTCGTATTGGGC‐3′, GAPDH reverse; 5′‐CTTGACGGTGCCATGGAATTTG‐3′.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.