New alleles and transgenes

The self-excision cassette (SEC) method was used to generate CRISPR alleles (Dickinson et al., 2015). GFP or ZF::GFP alleles also contain 3× FLAG and TagRFP-T alleles also contain 3× Myc. The plasmid pDD162 used to deliver Cas9 and each sgRNA was modified (Q5 Site-Directed Mutagenesis Kit, NEB) to insert the appropriate sgRNA guide sequence for each CRISPR edit. The repair template was generated by PCR-amplifying appropriate homology arm sequences for an N-terminal, C-terminal, or internal fluorophore insertions (Phusion High-Fidelity DNA polymerase, Thermo Scientific) and cloned into an SEC backbone plasmid (NEBuilder HiFi DNA Assembly Master Mix, NEB). The modified Cas9/sgRNA plasmid, repair template, and pBS were injected at 50 ng/μL each into N2 or zif-1(gk117) mutant 1-day-old adult worms. Injected worms were recovered and treated according to published protocols to isolate independent CRISPR edit events and excise the SEC. One exception is the PAR-6::tagRFP allele, for which the SEC was not excised. New CRISPR alleles were backcrossed at least twice before being used for subsequent experiments. The internal in-frame placement of the fluorophore in PAR-3 tags all isoforms without causing an obvious phenotype. PAR-6 was tagged at the C-terminus with ZF::GFP and ZF::GFP₁₁. Both ZF-tagged par-6 alleles resulted in fully penetrant larval arrest when degraded in the intestine (Figure 6A). sgRNA and homology arm sequences, plasmids, and primers used in constructing new CRISPR alleles are listed in Supplementary file 1.

Integrated and extrachromosomal arrays wowIs3[ifb-2p::zif-1] (IV or V) was derived by spontaneous integration of the extrachromosomal array wowEx34 (Sallee et al., 2018). wowIs28[elt-2p::zif-1] (II) was derived by spontaneous integration of an extrachromosomal array carrying SA109 (elt-2p::zif-1 at 50 ng/μL, Armenti et al., 2014), pJF248 (end-1p::histone::mCherry at 50 ng/μL), pCFJ90 (myo-2p::mCherry at 2.5 ng/μL, Frøkjaer-Jensen et al., 2008), and pBS (47.5 ng/μL). The YFP::ACT-5 transgene opIs310 was genetically linked to wowIs3, so wowIs28[elt-2p::zif-1] (II) was used instead for intestine-specific ZIF-1 expression.

An extrachromosomal array driving late degradation of PAR-6 in the embryonic intestine was generated by injecting pAL29 (asp-1p::zif-1 at 50 ng/μL), pCFJ90 (2.5 ng/μL), and pBS (47.5 ng/μL) into young adult zif-1(0) hermaphrodites. The 3 kb asp-1 promoter for pAL29 came from pJM481, a gift from James McGhee. Extrachromosomal arrays were also generated to provide intestine-specific expression of wild-type or mutant PKC-3. The plasmid pMS252 containing elt-2p::bfp::pkc-3::unc-54 3′UTR was generated by PCR-amplifying pkc-3 from N2 wild-type genomic DNA and the unc-54 3′UTR sequence from pSA109 with Phusion DNA polymerase, and using the NEBuilder Assembly Mix, PCR products were cloned into a plasmid carrying elt-2p::bfp (pMP27) digested with AfeI and XmaI. Mutations were introduced by Q5 mutagenesis to make pMS259 carrying a PKC-3(G336N) mutation (forward primer: ATTCGTTCCTaatGGTGATCTGATG; reverse primer: TCGATGACAAAGAACAGG), pMS264 carrying a PKC-3(K282A) mutation (forward primer: CGCGATAgcAATTATCAAAAA; reverse primer: TAAATTTGACGAGTTGAAACATG), and pMS260 carrying a deletion of the PKC-3 N-terminus carrying the PB1 domain (forward primer: AAACCAGAGCTGCCCGGG; reverse primer: AGCGCTGTTGAGCTTGTGTC). For the PKC-3 rescue assay, elt-2p::bfp::pkc-3 gDNA plasmids were each injected at 10 ng/μL into JLF148 or JLF155 young adult hermaphrodites along with pBS (115 ng/μL) as carrier DNA and unc-122p::GFP (25 ng/μL) to mark the coelomocytes, and independent lines were isolated and crossed into JLF491 to test for function.