2.2. DNA Extraction and 16S rRNA Gene Sequencing

DNA extraction was carried out using The PureLink™ Microbiome DNA Purification Kit (Thermofisher, Waltham, MA, USA) and quantification using a Qubit fluorometer (Thermofisher, Waltham, MA, USA), following the manufacturer’s instructions.

A total of 5 ng/μL of microbial DNA was amplified using gene-specific primers that target the bacterial 16S rRNA V3 and V4 regions. The full-length primers with overhang adapter sequences used for the study were, 16S Amplicon PCR Forward Primer: 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCC TACGGGNGGCWGCAG and 16S Amplicon PCR Reverse Primer: 5′ GTCTCGTGGGCTCGGAGATGTGTAT AAGAGACAGGACTACHVGGGTATCT AATCC. The PCR reaction consists of 2.5 μL of microbial DNA and 12.5 μL of 2 × KAPA HiFi HotStart Ready Mix PCR mix and 5 μL of 1 μM forward and reverse primers. The thermal amplification program consists of 3 min at 95 °C followed by 25 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C, and a final extension of 5 min at 72 °C. The resulting PCR product was confirmed on a Bioanalyzer using DNA 1000 chip and purified using AMPure XP beads following the manufacturer’s recommendation (Agilent Technologies, Santa Clara, CA, USA). Subsequently, amplicons were bound to dual indices and Illumina sequencing adapters using the Nextera XT Index Kit (Illumina Inc., San Diego, CA, USA) following the manufacturer’s recommendations. Purified and normalized libraries were multiplexed up to 23 samples and paired-end sequencing was carried out in MiSeq platform (Illumina Inc., San Diego, CA, USA).