dsRNA Preparation and Feeding

dsRNA was synthesized using T7 RiboMAX^TM Express RNAi System (Promega, United States). Each primer used for PCR contained a 5′ T7RNA polymerase binding site (GAATTAATACGACTCACTATAGGGAGA) followed by the sequence-specific for the target gene i.e., IDGF1, IDGF3_1, IDGF4_0, IDGF4_1, and IDGF6 (Supplementary Table 3). These primers were used to amplify the template for the synthesis of forward and reverse RNA. dsRNA was purified according to manufacturer’s instructions and the integrity and quantities of all synthesized dsRNA products were determined by 1.2% agarose gel electrophoresis. Their concentration was measured using the NanoDrop2000 spectrophotometer. dsRNA of green fluorescent protein (GFP) and DEPC was used as a negative control. To investigate the biological functions of each chitinase gene of Z. cucurbitae, dsRNA was fed to 2 days old third instar larvae for 48 h and then shifted to the new food contain dsRNA for another 48 h. Five biological replications were performed with sixty individuals in each replicate. Each replicates fed with 6 g artificial food contained 60 μl dsRNA (1,000 ng/μl), dsGFP, and DEPC. Larval body size, mortality, and phenotype were examined 24 h post-feeding at each developmental stage till the adult’s sexual maturity.